View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19185_low_25 (Length: 250)
Name: NF19185_low_25
Description: NF19185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19185_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 7e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 30 - 212
Target Start/End: Original strand, 7538660 - 7538846
Alignment:
| Q |
30 |
tagactagactgaattagtctttgcaagactcaagcttgatttgatnnnnnnnnnnn-----tcacgtcttagatctgagatgttatcaatcatatactt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7538660 |
tagactagactgaattagtctttgcaagactcaagcttgatttgataaaaaaaaaaaataaatcacgtcttagatctgagatgttatctatcatatactt |
7538759 |
T |
 |
| Q |
125 |
aattttaggtttgcatcttacctttttaaaactaacaaagtctttaaataagtaatatatccttaaatagactaatgaattaatagac |
212 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7538760 |
aattttaggtttgtatcttacctttttaaa-ctaacaaagtctttaaataagtaatatatccttaaatagactaatgaattaatagac |
7538846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University