View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19185_low_27 (Length: 250)
Name: NF19185_low_27
Description: NF19185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19185_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 25813512 - 25813750
Alignment:
| Q |
1 |
agagaggttcgtttaagagttcaactgcatatagactagggttttttgtatacctgcgtcgacgcatagaaatatatgataaatgtggtaagtaaagtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25813512 |
agagaggttcgtttaagagttcaactgcatatagactagggttttttgtatacctgcg---acgcatagaaatatatgataaatgtggtaagtaaagtat |
25813608 |
T |
 |
| Q |
101 |
caatttgaaacatataatgtgtggattattatgaaaaaatgtacaaatattatatgtattaaccttgctgttaggaagcttataacatcaactgtttgct |
200 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25813609 |
caatttgaaacatatgatgtatggattattatgaaaaaatgtacaaatagtatatgtattaaccttgctgttaggaagcttataacatcaactgtttgct |
25813708 |
T |
 |
| Q |
201 |
gaatattttcatctgattgtccccattcttgcgattcatctc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
25813709 |
gaatattttcatctgattgtccccattcttgtgatccatctc |
25813750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 25759160 - 25759103
Alignment:
| Q |
1 |
agagaggttcgtttaagagttcaactgcatatagactagggttttttgtatacctgcg |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25759160 |
agagaggttcgtttaagagttcaactgcatatagactagggttttttgtatacctgcg |
25759103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 55
Target Start/End: Original strand, 25788593 - 25788642
Alignment:
| Q |
1 |
agagaggttcgtttaagagttcaactgcatatagactagggttttttgtatacct |
55 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25788593 |
agagaggttcgtttaagagttcaa-----tatagactagggttttttgtatacct |
25788642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University