View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19185_low_30 (Length: 243)
Name: NF19185_low_30
Description: NF19185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19185_low_30 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 2 - 142
Target Start/End: Complemental strand, 12487925 - 12487785
Alignment:
| Q |
2 |
taattaataacttttatctaaaagtttatagttttgagataaagggatcgagtactataatagacatgattgaattggtcccttccctcatgtcatgtgt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12487925 |
taattaataacttttatctaaaagtttatagttttgagataaagggatcgagtactataatagacatgattgaattggtcccttccctcatgtcatgtgt |
12487826 |
T |
|
| Q |
102 |
aaattcagcacagtttgcaaggtggggaaaatttgttactt |
142 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12487825 |
gaattcagtacagtttgcaaggtggggaaaatttgttactt |
12487785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University