View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19185_low_33 (Length: 238)
Name: NF19185_low_33
Description: NF19185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19185_low_33 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 90 - 222
Target Start/End: Complemental strand, 12561063 - 12560931
Alignment:
| Q |
90 |
cgtaattcacattttcttctttgttcttatattccttaatttaaaatctacatgtgtgtcctacatatgaatttattatatttgctcatttttctacttc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12561063 |
cgtaattcacattttcttctttgttcttatattccttaatttaaaatctacatgtgtgtcctacatatgaatttattatatttgctcatttttctacttc |
12560964 |
T |
 |
| Q |
190 |
tattattttatcatctgtaatatatatttcatt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
12560963 |
tattattttatcatctgtaatatatatttcatt |
12560931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 12561152 - 12561120
Alignment:
| Q |
1 |
taaattacaaatatttcccacacccctctaatt |
33 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
12561152 |
taaattacaaacatttcccacacccctctaatt |
12561120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University