View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19186_low_4 (Length: 345)
Name: NF19186_low_4
Description: NF19186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19186_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 187 - 329
Target Start/End: Complemental strand, 6995399 - 6995257
Alignment:
| Q |
187 |
taggagaagttgttgaaggagaatgcttcactttctagtacagtgaggaagctcagtagagatgtctccaaggtgcaaactatttggttttcttagtcaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6995399 |
taggagaagttgttgaaggagaatgcttcactttctagtacagtgaggaagctcagtagagatgtctccaaggtgcaaactatttggttttcttagtcaa |
6995300 |
T |
|
| Q |
287 |
ttatcaattttcatttttgtaaaagtggtaaattaattcttgt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6995299 |
ttatcaattttcatttttgtaaaagtggtaaattaattcttgt |
6995257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 2 - 107
Target Start/End: Complemental strand, 6995583 - 6995478
Alignment:
| Q |
2 |
ggagagcctctccacgctgcgctttctgaagccgccgataagcttgcacttgctgaacaagataaggtctgaacccttgaaccgttatctaaattaaacc |
101 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6995583 |
ggagagcctctccacgctgctctttctgaagccgccgataagcttgcacttgctgaacaagataaggtctgaacccttgaaccgttatctaaattaaacc |
6995484 |
T |
|
| Q |
102 |
cggttc |
107 |
Q |
| |
|
|||||| |
|
|
| T |
6995483 |
cggttc |
6995478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University