View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19188_low_6 (Length: 270)
Name: NF19188_low_6
Description: NF19188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19188_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 46 - 262
Target Start/End: Original strand, 3724802 - 3725018
Alignment:
| Q |
46 |
gtgtagaaatatacatcaaatatattcctgttttcttacacctcattggaacaaaacttttaagattgttagatatttgaggaggagctaaatagaagtc |
145 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
3724802 |
gtgtagaactatacatcaaatatattcctgttttcttacacctcattggaacaaaacttttaagattgttggatatttgaggaggagctaaataaaagtc |
3724901 |
T |
 |
| Q |
146 |
tatcatgggatgggagagaaatgcatagaaaaaataagacatgagttgaaatttgactaatacacttactagattaagattacaaccatctgagtttaat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3724902 |
tatcatgggatgggagagaaatgcatagcaaaaatacgacatgagttaaaatttgactaatacacttactagattaagattacaaccatctgagtttaat |
3725001 |
T |
 |
| Q |
246 |
tttattgggttcatctc |
262 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
3725002 |
tttattggtttcatctc |
3725018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University