View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19189_high_22 (Length: 310)
Name: NF19189_high_22
Description: NF19189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19189_high_22 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 310
Target Start/End: Complemental strand, 13203500 - 13203179
Alignment:
| Q |
1 |
tgcatgcatgccatgactattcatttctatcacttagaccatggttttaaattgcggtttgtagaatgcaatttcagacacaatagaaaatgtttaga-- |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||| |
|
|
| T |
13203500 |
tgcatgcatgccatgactattcatttctatcacttagaccatggttttaaattgcggtttgtagactgcaatttcagaca--acagaaaatgtttagact |
13203403 |
T |
|
| Q |
99 |
-----gttgtgtgcaatgacataggcaaccacagttgt-------ttgctcaaatttgcttgcatttttgctgcaatattatcaagttagaactaattaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13203402 |
ttagagttgtgtgcaatgacataggcaaccacaattgtggcctcattgctcaaatttgcttgcatttttgctgcaatattatcaagttagaactaattaa |
13203303 |
T |
|
| Q |
187 |
gtattaacatttcctcnnnnnnnnnnnnnngtgtaattaggagagaccagtaacaaatccctcgatgccatggtgagttacttagtttataatcttttat |
286 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13203302 |
gtattaacatttcctcttttttttgtttttgtgtaactaggagagaccagtaacaaatccctcgatgccatggtgagttacttagtttataatcttttat |
13203203 |
T |
|
| Q |
287 |
atgattgtacattatacatacttt |
310 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
13203202 |
atgattgtacattatacatacttt |
13203179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University