View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19189_high_32 (Length: 283)
Name: NF19189_high_32
Description: NF19189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19189_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 275
Target Start/End: Complemental strand, 41686209 - 41685952
Alignment:
| Q |
18 |
taggagtcatcaatatcttgtcaaataattattaaccaacattatcataaaattgctgaatcatctagaagagctcttgttgatctctattttgttgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41686209 |
taggagtcatcaatatcttgtcaaataattattaaccaacgttatcataaaattgctgaaccatctagaagagctcttgttgatctctattttgttgttg |
41686110 |
T |
 |
| Q |
118 |
aaaaagacaacaatatatttatcaacatcctcaaaaagggggaaagatgattaatttcatgctcacgaaatgtgaattaggtgatgacaaattatttttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41686109 |
aaaaagacaacaatatatttatcaacatcctcaaaaagggggaaagatgattaatttcatgctcacgaaatgtgaattaggtgatgacaaattatttttt |
41686010 |
T |
 |
| Q |
218 |
cggctgcagacacaaggaacaggatcttttgaatttaacaggagctatgtattcagct |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41686009 |
cggctgcagacacaaggaacaggatcttttgaatttaacaggagctatgtattcagct |
41685952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University