View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19189_high_37 (Length: 253)
Name: NF19189_high_37
Description: NF19189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19189_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 8403903 - 8404123
Alignment:
| Q |
17 |
acaaatgatgatcctatagctgcaattcctgttaacaaaggtccaaaaattgctaaacccttgttaatctttgatgcaatattccctaatctctcataat |
116 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8403903 |
acaaatgatgaccctatagctgcaattcctgttaacaaaggtcctaaaattgctaaactcttgttaatctttaatgcaatattccctaatctctcataat |
8404002 |
T |
 |
| Q |
117 |
cctcaatatcttttctcttcaccacttcaattacctcattcatttcatcttccaattccaaattccacccattattgctctcattattaatctccatctt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||| | ||| ||||||||||||||| |
|
|
| T |
8404003 |
cctcaatatcttttctcttcaccacttcaattacctccttcatttcattttccaactccaaattccatccattattcccctc---attaatctccatctt |
8404099 |
T |
 |
| Q |
217 |
attgttcaatccagtaatattctt |
240 |
Q |
| |
|
| ||||| ||| ||| || ||||| |
|
|
| T |
8404100 |
actgttctatctagtcattttctt |
8404123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 137
Target Start/End: Original strand, 8368314 - 8368350
Alignment:
| Q |
101 |
cctaatctctcataatcctcaatatcttttctcttca |
137 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
8368314 |
cctaatctctcataatcttccatatcttttctcttca |
8368350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 137
Target Start/End: Complemental strand, 8401096 - 8401060
Alignment:
| Q |
101 |
cctaatctctcataatcctcaatatcttttctcttca |
137 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
8401096 |
cctaatctctcataatcttccatatcttttctcttca |
8401060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 101 - 137
Target Start/End: Complemental strand, 8422673 - 8422637
Alignment:
| Q |
101 |
cctaatctctcataatcctcaatatcttttctcttca |
137 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||| |
|
|
| T |
8422673 |
cctaatctctcataatcttccatatcttttctcttca |
8422637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University