View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19189_low_32 (Length: 289)
Name: NF19189_low_32
Description: NF19189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19189_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 6e-74; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 54 - 276
Target Start/End: Original strand, 7903867 - 7904092
Alignment:
| Q |
54 |
tcacccctaataccaatgctacgcccaaataatgatcttcatcgaagacatttttccttcaccannnnnnnnn---gttttgtaaaatctgctatgtttt |
150 |
Q |
| |
|
|||||| ||| ||||||||||||||||| |||||||||||| |||||| |||||||| ||| || |||||||||||||||||||||||| |
|
|
| T |
7903867 |
tcacccgtaacaccaatgctacgcccaactaatgatcttcaacgaagatatttttccctcaacattttttttttttgttttgtaaaatctgctatgtttt |
7903966 |
T |
|
| Q |
151 |
ttgtcatttagataatgtgagaaattgaaatctcttgtctgcattttaccgctgttgttctcggaagagggtgagttggaaagttcaaagtacagagata |
250 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7903967 |
ttgccatttagataatgtgagaaattgaaatctcttgtctgcattttaccgctattgttttcggaagagggggagttggaaagttcaaagtacagagata |
7904066 |
T |
|
| Q |
251 |
aaaatgattcatatcaagaagaaatt |
276 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
7904067 |
aaaatgattcatatcaagaagaaatt |
7904092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 182 - 235
Target Start/End: Original strand, 7896218 - 7896271
Alignment:
| Q |
182 |
ctcttgtctgcattttaccgctgttgttctcggaagagggtgagttggaaagtt |
235 |
Q |
| |
|
||||| |||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7896218 |
ctcttttctgtattttacagctgttgttctcggaagagggtgagttggaaagtt |
7896271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 147 - 231
Target Start/End: Original strand, 7913073 - 7913157
Alignment:
| Q |
147 |
ttttttgtcatttagataatgtgagaaattgaaatctcttgtctgcattttaccgctgttgttctcggaagagggtgagttggaa |
231 |
Q |
| |
|
|||||||||||| ||||||| ||||||| ||||||||||||||| | |||||| ||||||||| ||| || | | |||||||||| |
|
|
| T |
7913073 |
ttttttgtcattcagataatatgagaaactgaaatctcttgtcttccttttacagctgttgttttcgaaaaatgatgagttggaa |
7913157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 54 - 101
Target Start/End: Original strand, 7912966 - 7913013
Alignment:
| Q |
54 |
tcacccctaataccaatgctacgcccaaataatgatcttcatcgaaga |
101 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
7912966 |
tcacccctaacaccaatgctacgcccatataatgatcttcatcgaaga |
7913013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University