View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19189_low_38 (Length: 261)
Name: NF19189_low_38
Description: NF19189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19189_low_38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 21 - 251
Target Start/End: Original strand, 55994528 - 55994758
Alignment:
| Q |
21 |
gcggcacttcagagacagatatcattctgcagcaagaacagaatggtgtcctccaaacccctttatctccccaatgtataactgaaaaacaagaagcaga |
120 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55994528 |
gcggcacttcagagacagatatcaatctgcagcaagaacagaatggtgtcctccaatcccctttatctccccaatgtataactgaaaaacaagaagcaga |
55994627 |
T |
 |
| Q |
121 |
attcaagttcaggctagtgttcttgtgtttagcagcatacctaggcacaggtaccttgtgtttctatctaacaagttaccaaattgagggcataaaaaca |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
55994628 |
attcaagttcaggctagtgttcttgtgtttagcagcatacctaggcacaggtaccttatgtttctatctaacaagttaccaaattgaaggcataaaaaca |
55994727 |
T |
 |
| Q |
221 |
aatggatttcttgatgccctttatttctgtg |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
55994728 |
aatggatttcttgatgccctttatttctgtg |
55994758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University