View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19189_low_54 (Length: 219)
Name: NF19189_low_54
Description: NF19189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19189_low_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 147
Target Start/End: Complemental strand, 41124380 - 41124234
Alignment:
| Q |
1 |
tttttatgcttgaaaatgaaataactattttgattagctttcatctttaataaaatagagaaaagtataatttatagtgtctatgatttttgaaccatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41124380 |
tttttatgcttgaaaatgaaataactattttgattagctttcatctttaataaaatagagaaaagtataatttatagtgtctatgatttttgaaccatat |
41124281 |
T |
 |
| Q |
101 |
aacaaaaatcgttttagacaatctataacaaacaagccctaaaagtg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41124280 |
aacaaaaatcgttttagacaatctataacaaacaagccctaaaagtg |
41124234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 167 - 219
Target Start/End: Complemental strand, 41124241 - 41124189
Alignment:
| Q |
167 |
taaaaatgtcaagtagaggaacatgcataaataagatgaaaagagtatatatc |
219 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41124241 |
taaaagtgtcaagtagaggaacatgcataaataagatgaaaagagtatatatc |
41124189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University