View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_high_33 (Length: 322)
Name: NF1918_high_33
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 214 - 277
Target Start/End: Complemental strand, 38028477 - 38028414
Alignment:
| Q |
214 |
atttaagataatagttctctacaacttgaaaacaatatttattaaaatgaaaaagatgtattat |
277 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38028477 |
atttgagataatagttctctacaccttgaaaacaatatttattaaaatgaaaaagatgtattat |
38028414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University