View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_high_39 (Length: 288)
Name: NF1918_high_39
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_high_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 7 - 273
Target Start/End: Complemental strand, 955898 - 955632
Alignment:
| Q |
7 |
gaagcaaagggagaatgcagtcagaatggtagaaatgtttgcatggtaactctctcacttccacatcaacctcaaactcatctttgcatattggacaatt |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
955898 |
gaagccaagggagaatgcagtcagaatggtagaaatgtttgcatggtaactctctcacttgcacatcaacctcaaactcatctttgcatattggacaatt |
955799 |
T |
 |
| Q |
107 |
cggatcacttgctaaatgtgtttctgttaccttaaccattggcaaggcttcaatggccgaaggtgacgctggaggcggccccggtctaatgttgttgtga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
955798 |
cggatcacttgctaaatgtgtttctgttaccttaaccattggcaaggcttcaatggccgaaggtgacgctggaggcggccccggtctaatgttgttgtga |
955699 |
T |
 |
| Q |
207 |
atcacaccatcaaagaactcgtctaatgacggggtttcaatgtcattgagttgaggagccatgtttt |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
955698 |
atcacaccatcaaagaactcgtctaatgacggggtttcaatgtcattgagttgaggagccatgtttt |
955632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University