View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_high_48 (Length: 262)
Name: NF1918_high_48
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_high_48 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 1505441 - 1505204
Alignment:
| Q |
1 |
aatagtagtaacaatcatttgatattaacactagaatgttgtctttctttaaggatcataaatataaattagtcaaatgtggtatgctaatgtctaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1505441 |
aatagtagtaacaatcatttgatattaacactagaatgttgtctttctttaaggatcataaatataaattagtcaaatgtggtatgctaatgtctaaatt |
1505342 |
T |
|
| Q |
101 |
tctctctttattgaaagtcaataaaacaatcaaacttatttgnnnnnnnnnnnnnnncaatataattagaagggacttattaacttgcattggatagaaa |
200 |
Q |
| |
|
||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1505341 |
tctatctttattgaaagtcaatcaaacaatcaaacttatttg-----ttttttttctcaatataattagaagggacttattaacttgcattggatagaaa |
1505247 |
T |
|
| Q |
201 |
acataggaaattccccccaatttaccgtaaatattgaatatcc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1505246 |
acataggaaattccccccaatttaccgtaaatatagaatatcc |
1505204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University