View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_high_57 (Length: 238)
Name: NF1918_high_57
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_high_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 5034031 - 5033832
Alignment:
| Q |
17 |
agctaaaggagtgtttggctgcagaattatcccgaaaaagggctggtcgggtagatcatttccatacacataatttctgtcttccctttacttacaagct |
116 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5034031 |
agctaaaggagtatttggctgcagaattatcccgaaaaagggctggtcgggtagatcatttccatacacataatttctgtcttccctttacttacaagct |
5033932 |
T |
 |
| Q |
117 |
acaactccaagtctccaagtcacagccatcttaatgttgaaataagc-aataataaaaaggcaacataactataaaaccatataagatgtggtaaacagc |
215 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5033931 |
acaactcca--------agtcacagccatcttaatgttgaaataagcaaataataaaaaggcaacataactataaaaccatataagatgtggtaaacagc |
5033840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 61
Target Start/End: Original strand, 4974723 - 4974768
Alignment:
| Q |
16 |
gagctaaaggagtgtttggctgcagaattatcccgaaaaagggctg |
61 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
4974723 |
gagctaaaggagtgtttggctgcagaattagcccgaaaaggggctg |
4974768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 4999673 - 4999720
Alignment:
| Q |
18 |
gctaaaggagtgtttggctgcagaattatcccgaaaaagggctggtcg |
65 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| || |||||| |
|
|
| T |
4999673 |
gctaaaggagtgtttggctgaagaattagcccgaaaaaaggttggtcg |
4999720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University