View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_high_61 (Length: 223)
Name: NF1918_high_61
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_high_61 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 53 - 204
Target Start/End: Complemental strand, 1529664 - 1529513
Alignment:
| Q |
53 |
cgttatgccgaacatggccgtcccggcgaggttttatctgtacatttttagatggcgaaacagtgtagatagtgccgaaaatagaggcgataagggtgaa |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1529664 |
cgttatgccgaacatggccgtcccggcgaggttttatctgtacatttttagatggcgaaacagtgtagatagtgccgaaaatagaggcgataagggtgaa |
1529565 |
T |
 |
| Q |
153 |
tgggttgctgttctatgagagatgaaatttgtgtggagaagagattgtagat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1529564 |
tgggttgctgttctatgagagatgaaatttgtgtggagaagagattgtagat |
1529513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 59 - 118
Target Start/End: Complemental strand, 26841426 - 26841367
Alignment:
| Q |
59 |
gccgaacatggccgtcccggcgaggttttatctgtacatttttagatggcgaaacagtgt |
118 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26841426 |
gccgaacatggctgttccggcgaggttttatctgtacatttttagatggcgaaacagtgt |
26841367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University