View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_low_23 (Length: 384)
Name: NF1918_low_23
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 2e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 91 - 184
Target Start/End: Complemental strand, 24497034 - 24496941
Alignment:
| Q |
91 |
ttaatgtcactctttatgtttctgccttgcaatgaattatggtgatattatatgaattttttgttatgttgatctgtatttgataactattgaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24497034 |
ttaatgtcactctttatgtttctgccttgcaatgaattatggtgatattatatgtattttttgttatgttgatctgtatttgataactattgaa |
24496941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 242 - 277
Target Start/End: Original strand, 24496902 - 24496937
Alignment:
| Q |
242 |
tgagaaactagaaattgagaattcaattcaatgcca |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24496902 |
tgagaaactagaaattgagaattcaattcaatgcca |
24496937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University