View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_low_27 (Length: 364)
Name: NF1918_low_27
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 35973555 - 35973248
Alignment:
| Q |
1 |
agatctgtcgctcaaccttctctggtgattcctcttaggactcggcatggaatatccttgatcgaatcggattgaaaagggctgaatataatcgagactg |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35973555 |
agatctctcgctcaaccttctctggtgattcctcttaggactcggcatggaatgtcgttgatcgaatcggattgacaagggctgaatataatcg------ |
35973462 |
T |
 |
| Q |
101 |
gttgaatgattatgtatatgtgcaggggtgaaattggaatttgaggaaagttttactaccttagacggcggtagcgaacataacggcggcgaggaaagcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973461 |
gttgaatgattatgtatatgtgcaggggtgaaattggaatttgaggaaagttttgctaccttagacggcggtagcgaacataacggcggcgaggaaagcc |
35973362 |
T |
 |
| Q |
201 |
gagagctaaggaaaagcttcggcggagttgttgacgtggagcggaagctagcataaccagaagggtagaacagtaaataacccgagcaagagcaacgatg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35973361 |
gagagctaaggaaaagcttcggcggagttgttgacgtggagcggaagctagcataaccagaagggtagaacagtaaataacccgagcaagagcaacgatg |
35973262 |
T |
 |
| Q |
301 |
aatgaatgaatgaa |
314 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35973261 |
gatgaatgaatgaa |
35973248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University