View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_low_36 (Length: 321)
Name: NF1918_low_36
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-124; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 19 - 280
Target Start/End: Complemental strand, 9439771 - 9439510
Alignment:
| Q |
19 |
tcatgtcccatttgtagagtagcttatttatgtatcattatgaagctagactcatatcttattttttggagacatgattaggttgactaactgcatttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| | |||||||||||| |
|
|
| T |
9439771 |
tcatgtcccatttgtagagtagcttatttatgtatcattatgaagctagactcatatcttatttgttggagacatgattatgttcgcaaactgcatttgt |
9439672 |
T |
|
| Q |
119 |
gaatcataggagtgagaaagtatttggatagtaagaaaaaggtagaagaaaaccagaggttactctgcagagtcagatacaacattttctatccttaaat |
218 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439671 |
gaatcataggagtgacaaagtatttggatagtaagcaaaaggtagaagaaaaccagaggttactctgcagagtcagatacaacattttctatccttaaat |
9439572 |
T |
|
| Q |
219 |
ccattaggatagatcctcttccactctcccactttcttcttataatttttgcgaattccctc |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
9439571 |
ccattaggatagatcctcttccactctcccactttcttcatataattcttgcgaattccctc |
9439510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 97
Target Start/End: Complemental strand, 9432237 - 9432185
Alignment:
| Q |
45 |
tttatgtatcattatgaagctagactcatatcttattttttggagacatgatt |
97 |
Q |
| |
|
||||||||||||||| || |||||||||||||| ||||||||| |||||||| |
|
|
| T |
9432237 |
tttatgtatcattattgagatagactcatatcttcttttttggacacatgatt |
9432185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 97
Target Start/End: Complemental strand, 9420076 - 9420023
Alignment:
| Q |
44 |
atttatgtatcattatgaagctagactcatatcttattttttggagacatgatt |
97 |
Q |
| |
|
|||||||||| ||||| || |||||||||||||| ||||||||| |||||||| |
|
|
| T |
9420076 |
atttatgtatgattattgagatagactcatatcttcttttttggacacatgatt |
9420023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University