View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_low_43 (Length: 282)
Name: NF1918_low_43
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 70 - 270
Target Start/End: Complemental strand, 16951002 - 16950805
Alignment:
| Q |
70 |
atgtaagtgtaatcatcacattaacataagacaaacacattcataatggcaatacaactaaggatggaagttatgtccaaagaatagatgatgaatattg |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
16951002 |
atgtaagtgtaatcatcacattaacataagacaaacacattcataatggcaatacaactaaggatggatgttatgtccaaagaatagatga---atattg |
16950906 |
T |
 |
| Q |
170 |
tgtatcctttacagcaagaagcggtaaaaaggtgggaaaagggatagtttatcactttcgtgttgatgaaagttcgatggaagacaaagaacaaaggcat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16950905 |
tgtatcctttacagcaagaagcggtaaaaaggtgggaaaagggatagtttatcactttcgtgttgatgaaagttcgatggaagacaaagaacaaaggcat |
16950806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University