View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_low_45 (Length: 278)
Name: NF1918_low_45
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 2415802 - 2415573
Alignment:
| Q |
1 |
caccaaagaatggattctactcgaactcaatgtaattcgttcctcaatctctctccctccatttctcagtttcattagcnnnnnnnnnnnnnngaaatcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2415802 |
caccaaagaatggattctactcgaactcaatgtaattcgttcctcaatctctctccctccatttctcagtttcattagcttttttattttt--gaaatcg |
2415705 |
T |
|
| Q |
101 |
gtacttaggttattgaattttactatactta------gagagtgttcgtgctgaaattttgtaaatcgattttgannnnnnnaattaagttaatgaagtt |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
2415704 |
gtacttaggttattgaattttactatacttatacttagagagtgttcgtgctgaaattttgtaaatcgattttgatttttttaattaagttaatgaagtt |
2415605 |
T |
|
| Q |
195 |
tctcgaattgtgattttaggtttcttgcttta |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2415604 |
tctcgaattgtgattttaggtttcttgcttta |
2415573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University