View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_low_53 (Length: 248)
Name: NF1918_low_53
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_low_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 11 - 235
Target Start/End: Complemental strand, 29677754 - 29677530
Alignment:
| Q |
11 |
caaaggaaactcaaaattaactacaatgaaaatgtctaaactatgtagcacaacttgcaataaactaaaagaataatgtatgttagattggaaaaactac |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29677754 |
caaaggaaactcaaaattaactacaatgaaaatgtctaaaccatgtagcacaacttgcaataaactaaaagaataatgtatgttagattggaaaaactac |
29677655 |
T |
|
| Q |
111 |
ctggtcaagcttacaagcacccagatactttggtgtgatgtcgacttttgcagatggcgagttttgaagcaagaatttaactattccgtctagtatggga |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29677654 |
ctggtcaagcttacaagcacccagatactttggtgtgatgtcgacttttgcagatggcgagttttgaagcaagaatttaactattccgtctagtatggga |
29677555 |
T |
|
| Q |
211 |
ggtggttcataacctgcttgaggtg |
235 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
29677554 |
ggtggttcataacctgcttgaggtg |
29677530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 11 - 229
Target Start/End: Complemental strand, 28126179 - 28125961
Alignment:
| Q |
11 |
caaaggaaactcaaaattaactacaatgaaaatgtctaaactatgtagcacaacttgcaataaactaaaagaataatgtatgttagattggaaaaactac |
110 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28126179 |
caaaggaaagtcaaaattaactacaatgaaaatatctaaactgtgtagcacaacttgcaataaactaaaagaataatgtatgttagattggaataactac |
28126080 |
T |
|
| Q |
111 |
ctggtcaagcttacaagcacccagatactttggtgtgatgtcgacttttgcagatggcgagttttgaagcaagaatttaactattccgtctagtatggga |
210 |
Q |
| |
|
||| ||||||||| ||||||| ||||||||| ||||||||| |||||||| |||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
28126079 |
ctgctcaagcttaagagcacccggatactttgttgtgatgtcaacttttgcggatggcgagttttgaagcaagagtttaactattccgtccggtatggga |
28125980 |
T |
|
| Q |
211 |
ggtggttcataacctgctt |
229 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
28125979 |
ggtggttcagaacctgctt |
28125961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 36627066 - 36627139
Alignment:
| Q |
144 |
tgtgatgtcgacttttgcagatggcgagttttgaagcaagaatttaactattccgtctagtatgggaggtggtt |
217 |
Q |
| |
|
|||||| || ||||||||||| |||||||||||||||||||| || |||||||| || |||||| |||||||| |
|
|
| T |
36627066 |
tgtgatatcaacttttgcagacggcgagttttgaagcaagaagttgactattccatcaggtatggaaggtggtt |
36627139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 218
Target Start/End: Original strand, 36635813 - 36635864
Alignment:
| Q |
167 |
gcgagttttgaagcaagaatttaactattccgtctagtatgggaggtggttc |
218 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
36635813 |
gcgagttttgacgcaagaattcaactattccatcaggtatgggaggtggttc |
36635864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 217
Target Start/End: Complemental strand, 43946595 - 43946526
Alignment:
| Q |
148 |
atgtcgacttttgcagatggcgagttttgaagcaagaatttaactattccgtctagtatgggaggtggtt |
217 |
Q |
| |
|
||||| ||||| | ||| |||||||||||||| ||||| | ||||||||| ||| ||||||||| ||||| |
|
|
| T |
43946595 |
atgtcaactttcgtagacggcgagttttgaagtaagaagtcaactattccatcttgtatgggagttggtt |
43946526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 19657192 - 19657265
Alignment:
| Q |
144 |
tgtgatgtcgacttttgcagatggcgagttttgaagcaagaatttaactattccgtctagtatgggaggtggtt |
217 |
Q |
| |
|
|||||||| |||||||| || || ||||||||||||||||| ||||||||| ||| ||||||||||||||| |
|
|
| T |
19657192 |
tgtgatgtgaacttttgcggacggagagttttgaagcaagaaggcaactattccatctggtatgggaggtggtt |
19657265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 144 - 217
Target Start/End: Original strand, 19674036 - 19674109
Alignment:
| Q |
144 |
tgtgatgtcgacttttgcagatggcgagttttgaagcaagaatttaactattccgtctagtatgggaggtggtt |
217 |
Q |
| |
|
|||||||| |||||||| || || ||||||||||||||||| ||||||||| ||| ||||||||||||||| |
|
|
| T |
19674036 |
tgtgatgtgaacttttgcggacggagagttttgaagcaagaaggcaactattccatctggtatgggaggtggtt |
19674109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University