View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_low_57 (Length: 239)
Name: NF1918_low_57
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_low_57 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 27 - 217
Target Start/End: Original strand, 30864755 - 30864948
Alignment:
| Q |
27 |
ctactttatacgttttgaatgttattaatattatttacctttcattttagggtaattaataatgatattatggtttcataaattaattccatattcatgg |
126 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30864755 |
ctactttatacattttgaatgttattaatattattcacctttaattttagggtaattaatcatgatattatggtttcataaattaattccatattcatgg |
30864854 |
T |
 |
| Q |
127 |
tgattttttagattgatttgtagt---tcatcaaagtgatgtttagtccttgatcacgatcagacgttgatccacatatcaccgcgagattcat |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30864855 |
tgattttttagattgatttgtagttcatcatcaaagtgatgtttagtccttgatcacgatcagacgttgatccacatatcacagcgagattcat |
30864948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University