View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1918_low_60 (Length: 235)
Name: NF1918_low_60
Description: NF1918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1918_low_60 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 9 - 219
Target Start/End: Complemental strand, 6344193 - 6343983
Alignment:
| Q |
9 |
atcatcatcaaaacaccatattaattcgagagattatcatattgcaacctgcaaccccttcttgaaaaataactttgttgtgacccaaccaaagaatcca |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6344193 |
atcatcatcaaaacaccatattaattcgagagattatcatattgcaacctgcaaccccttcttgaaaaataactttgttgtgacccaaccaaagaatcca |
6344094 |
T |
|
| Q |
109 |
acgatagtcaaccaaataagaaaacaagttcttgtcaaacgcttattcaagaccaagttcatacgcataaagagttgttgaacaccttcattatgtttta |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6344093 |
acgatagtcaaccaaataagaaaacaagttcttgtcaaacgcttattcaagaccaagttcatacgcataaagagttgttgaacaccttcattatgtttta |
6343994 |
T |
|
| Q |
209 |
caccttgaata |
219 |
Q |
| |
|
||||||||||| |
|
|
| T |
6343993 |
caccttgaata |
6343983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 87
Target Start/End: Original strand, 1051253 - 1051319
Alignment:
| Q |
21 |
acaccatattaattcgagagattatcatattgcaacctgcaaccccttcttgaaaaataactttgtt |
87 |
Q |
| |
|
||||||| |||||| ||||||||||| ||||||| | |||||||||||| ||||||||| ||||| |
|
|
| T |
1051253 |
acaccattttaatttgagagattatcgaattgcaatccacaaccccttcttaaaaaataacattgtt |
1051319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University