View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19190_low_6 (Length: 254)
Name: NF19190_low_6
Description: NF19190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19190_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 52140385 - 52140290
Alignment:
| Q |
1 |
aaatggatgcacttatggtattacatcgtgtgatcaatgctcacgacctatgaaccgtgaccaaacatgtcgtgttgctatgaaagatcaagatgt |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||| ||| ||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
52140385 |
aaatggatgcacttatggtattacatcgtgtgatcaatgctcgcaacctatgaaccgggacgaaacacgtcatgttgctatgaaagatcaaaatgt |
52140290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 78 - 232
Target Start/End: Complemental strand, 52130680 - 52130526
Alignment:
| Q |
78 |
ctatgaaagatcaagatgtaactttcatgttgatggatgatttggttattcatcccttctcaccaatttcaattgttacgttacttaacaagttcgattt |
177 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||| || ||||| ||| ||| | |||||||| || |||||||| | ||||||||| || | |
|
|
| T |
52130680 |
ctatgaaagatcaaaatgtaattttcatgttgatggatgatttagtgattcagcccatcttagcaatttcagttattacgttaatcaacaagttcaatat |
52130581 |
T |
|
| Q |
178 |
caaacaagtccataacttgcaagaaatggtggttgaatttgggatggatgaggta |
232 |
Q |
| |
|
||||||||| | || |||||||| |||||||| ||||| ||| |||||||| |
|
|
| T |
52130580 |
caaacaagttggtgcctctcaagaaattgtggttgagtttggtatgaatgaggta |
52130526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 193 - 232
Target Start/End: Complemental strand, 52154314 - 52154275
Alignment:
| Q |
193 |
cttgcaagaaatggtggttgaatttgggatggatgaggta |
232 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
52154314 |
cttgcaagaaatggtggttgaattggggctggatgaggta |
52154275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 17525331 - 17525380
Alignment:
| Q |
1 |
aaatggatgcacttatggtattacatcgtgtgatcaatgctcacgacctat |
51 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||| | |||||| |
|
|
| T |
17525331 |
aaatggatgcacttaaggtattacatcgtg-gatcaatgctcgcaacctat |
17525380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University