View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19190_low_7 (Length: 236)
Name: NF19190_low_7
Description: NF19190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19190_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 3 - 224
Target Start/End: Complemental strand, 26915029 - 26914808
Alignment:
| Q |
3 |
tttgagttttaaatacatattgagttttaaatgtgcttggggcttggggccaacgcacatttttattgtcttattatatgtagattatcttatctacact |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26915029 |
tttgagttttaaatacatattgagttttaaatgtgcttggggcttgtggccaacgcacatttttattgtcttattatatgtagattatcttatctacact |
26914930 |
T |
 |
| Q |
103 |
aaaatcaatatgaagatgaaaaatgaactaaaaaagacatttgatatgaccatcttttgtcgtgatttactacttcctcgacatataagtgaacnnnnnn |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26914929 |
aaaatcaatatgaagatgaaaaatgaactaaaaaagacatttgatatgaccatcttttgtcgtgatttactacttcctcgacatataagtgaacaaaaaa |
26914830 |
T |
 |
| Q |
203 |
nnnttatttcacgaaagaaatg |
224 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
26914829 |
aaattatttcacgaaagaaatg |
26914808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University