View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19191_low_7 (Length: 274)
Name: NF19191_low_7
Description: NF19191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19191_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 21 - 258
Target Start/End: Complemental strand, 52324639 - 52324403
Alignment:
| Q |
21 |
aatctcataaatttaaaatgtgaaaccaatttattctccttgattttcattttcagcagcaaaattgcgataaaaatacaatataatgtgacataagtga |
120 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52324639 |
aatctcataaatttaaaatttgaaaccaatttattctccttgattttcattttcagcagcaaaattgcgataaaaa-acaatataatgtgacataagtga |
52324541 |
T |
|
| Q |
121 |
tatatgtttgaaccttctagttctagtagtgaaaacaacataaggaattatattcagttgttattatcactataaaataagaaatacctgcaccaccgag |
220 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52324540 |
tagatgtttgaaccttctagttctagtagtgaaaacaacataaggaattatattcagttgttattatcactataaaataagaaatacctgcaccaccgag |
52324441 |
T |
|
| Q |
221 |
gaaataggacttggtggaggcaggaggtgtcaccactg |
258 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52324440 |
gaaataggacttgggggaggcaggaggtgtcaccactg |
52324403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 199 - 257
Target Start/End: Complemental strand, 52327586 - 52327528
Alignment:
| Q |
199 |
aagaaatacctgcaccaccgaggaaataggacttggtggaggcaggaggtgtcaccact |
257 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| | ||||||||||||||| |
|
|
| T |
52327586 |
aagaaatacctgcaccaccgagaaaataggacttggtggacgacggaggtgtcaccact |
52327528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University