View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_high_107 (Length: 245)
Name: NF19192_high_107
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_high_107 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 13762197 - 13761963
Alignment:
| Q |
18 |
attaaattttagagtgcattaactttgacaacatttggtttcaaattaggcaattaatggggcttatttttgcggacgctcttcatttgtccgatcatgt |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13762197 |
attaaattttagagtgtattaactttgacaacatttggtttcaaattaggcaattaatggggcttatttttgcggaccctcttcatttgtccgatcatgt |
13762098 |
T |
|
| Q |
118 |
ttggttagccattgtttgggttagtttaatggaaagaaatatttatgttgtttgcgacaaaaagaagagac-atcgcttgctcgagttaagtta------ |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||| ||| |
|
|
| T |
13762097 |
ttggttagccattgtttgggttagtttaatggaaagaaatatttatgttgtttgcgacaaaaagaagagacaatcgtttactcgagttaaattatctttt |
13761998 |
T |
|
| Q |
211 |
ttgtggttgaaagcagtaaacacgagtttatttgt |
245 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
13761997 |
ttgtggttgaaagcagtaaacatgagtttatttgt |
13761963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University