View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_high_122 (Length: 236)
Name: NF19192_high_122
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_high_122 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 22 - 142
Target Start/End: Complemental strand, 31205024 - 31204904
Alignment:
| Q |
22 |
atcaacattgaagtttttcagcaaataaaatgctgccttgtaacagtaatgagattataagaaaacatacaaaaaatgacaaccatgtgagcctagctta |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||| |
|
|
| T |
31205024 |
atcaacattgaagtttttcagcaaataaaatgctgccttgtaacagtaatgagattataagaaaaaatacaaaaaatgacaaccatgtgagctttgctta |
31204925 |
T |
|
| Q |
122 |
atcaacctgaaagaggggaaa |
142 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31204924 |
atcaacctgaaagaggggaaa |
31204904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 23 - 115
Target Start/End: Complemental strand, 7744476 - 7744386
Alignment:
| Q |
23 |
tcaacattgaagtttttcagcaaataaaatgctgccttgtaacagtaatgagattataagaaaacatacaaaaaatgacaaccatgtgagcct |
115 |
Q |
| |
|
||||| |||| ||||||||||||| |||||||| ||||||| ||||||||||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
7744476 |
tcaaccttgaggtttttcagcaaacaaaatgctcccttgtatcagtaatgagattgaaaagaaac--acaaaaaatgacaaccatgtgagcct |
7744386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University