View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_high_125 (Length: 228)
Name: NF19192_high_125
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_high_125 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 30667515 - 30667450
Alignment:
| Q |
145 |
ggaattccgagaaaatcagaggggaagagaaattagaacattacaccaattccatgaccactttac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30667515 |
ggaattccgagaaaatcagaggggaagagaaattagaacattacaccaattccatgacaactttac |
30667450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 81
Target Start/End: Complemental strand, 30667646 - 30667579
Alignment:
| Q |
14 |
gaaatgaacggatcaattgtaaagcataattctcaacttatagtagatagactagaaggtagtacaat |
81 |
Q |
| |
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30667646 |
gaaatggacgaatcaattgtaaagcataattctcaacttatagtagatagactagaaggtagtacaat |
30667579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University