View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19192_high_125 (Length: 228)

Name: NF19192_high_125
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19192_high_125
NF19192_high_125
[»] chr8 (2 HSPs)
chr8 (145-210)||(30667450-30667515)
chr8 (14-81)||(30667579-30667646)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 145 - 210
Target Start/End: Complemental strand, 30667515 - 30667450
Alignment:
145 ggaattccgagaaaatcagaggggaagagaaattagaacattacaccaattccatgaccactttac 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
30667515 ggaattccgagaaaatcagaggggaagagaaattagaacattacaccaattccatgacaactttac 30667450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 81
Target Start/End: Complemental strand, 30667646 - 30667579
Alignment:
14 gaaatgaacggatcaattgtaaagcataattctcaacttatagtagatagactagaaggtagtacaat 81  Q
    |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30667646 gaaatggacgaatcaattgtaaagcataattctcaacttatagtagatagactagaaggtagtacaat 30667579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University