View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_high_128 (Length: 221)
Name: NF19192_high_128
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_high_128 |
 |  |
|
| [»] scaffold0119 (2 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold1348 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
| [»] scaffold0360 (1 HSPs) |
 |  |  |
|
| [»] scaffold0352 (1 HSPs) |
 |  |  |
|
| [»] scaffold0067 (1 HSPs) |
 |  |  |
|
| [»] scaffold0053 (1 HSPs) |
 |  |  |
|
| [»] scaffold0495 (1 HSPs) |
 |  |  |
|
| [»] scaffold0778 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 6e-33; HSPs: 34)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 101 - 204
Target Start/End: Complemental strand, 51975817 - 51975714
Alignment:
| Q |
101 |
aatatgtattctttctatatctatatattaattttaataaaatgatttaggatatagtgatattgacttaggatctgagaattaatttctcaaattcgat |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||||| || |||||||||| || |
|
|
| T |
51975817 |
aatatgtattctttcaatatctatatattaattctaataaaatgatttaggatatagtggtattgacttagaatctgagaatcaaggtctcaaattcaat |
51975718 |
T |
 |
| Q |
201 |
tctt |
204 |
Q |
| |
|
|||| |
|
|
| T |
51975717 |
tctt |
51975714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 54158347 - 54158266
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54158347 |
gtgaggtcccgggttcgaacccggatcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
54158266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 7824501 - 7824585
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7824501 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagacaat |
7824585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 29689529 - 29689613
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29689529 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagacaat |
29689613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 55018081 - 55018165
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
|||||||||| ||||||||||||| || | ||||| ||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
55018081 |
gtgaggtcccgggttcgaacccgggtcacgacgtccggccttgcaattttgacatttgccagttgagttaggacttctagacaat |
55018165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 28844585 - 28844503
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||| |||||||||||||||| || ||||||| ||||||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
28844585 |
gtgaggttccaggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgtcagttgagctagaacttctagaca |
28844503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 35461526 - 35461607
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| || |||||||||||||||| ||||||| | ||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
35461526 |
gtgaggttccgggttcgaacccggatcacaacgtccgaccttgcaatttcggcatttgccagttgagctagaacttctagac |
35461607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 43247697 - 43247778
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||| | || ||||||| ||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
43247697 |
gtgaggtcccgggttcgaacccaggtcacaacgtccggccttgcaattttggcatttgccagttgagctaggacttctagac |
43247778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 52500919 - 52500838
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| |||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52500919 |
gtgaggtttcaggttcgaacccggatcatgacgtccggccttacaatttcgacatttgccagttgagctaggacttctagac |
52500838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 54151728 - 54151809
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54151728 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
54151809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 1778932 - 1778846
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaatat |
105 |
Q |
| |
|
||||||| || ||||||||||||| || ||| ||| ||||||||||||||| |||||| ||||||||||||||||||||||| |||| |
|
|
| T |
1778932 |
gtgaggttccgggttcgaacccgggtcacaatgtccggccttgcaatttcggcatttgtcagttgagctaggacttctagacgatat |
1778846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 4601506 - 4601425
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| || ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4601506 |
gtgaggttccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
4601425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 42392852 - 42392933
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||| |||||||| ||||| | ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42392852 |
gtgaggtcccgggttcgagcccggatcatgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagac |
42392933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 100
Target Start/End: Complemental strand, 41377667 - 41377584
Alignment:
| Q |
17 |
cagtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||| |||||||||| ||||| ||||| |||||| |||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
41377667 |
cagtgaggtcccgggttcgaacctggatcatgacgtccggccttacaattttggcatttgccagttgagctaggacttctagac |
41377584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 22 - 100
Target Start/End: Original strand, 51665975 - 51666053
Alignment:
| Q |
22 |
aggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| ||||||||||| | || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51665975 |
aggtcccgggttcgaacccaggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
51666053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 36229041 - 36229110
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagcta |
88 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
36229041 |
gtgaggtcccgggttcgaacccggatcatgacgtccggccttgcaatttcggcatttgccagttgagcta |
36229110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 33334689 - 33334605
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
|||||||||| | ||||||| | | || ||||||| ||| ||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
33334689 |
gtgaggtcccggattcgaactcaggtcacaacgtccggctttgcaatttcggcatttgcaagttgagctaggacttctagacaat |
33334605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 39 - 101
Target Start/End: Complemental strand, 28458724 - 28458662
Alignment:
| Q |
39 |
ccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||| | || ||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
28458724 |
ccggatcacgacatctggccttgcaatttcgacatttgtcagttgagttaggacttctagaca |
28458662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 84
Target Start/End: Original strand, 9349723 - 9349788
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttga |
84 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
9349723 |
gtgaggtcccgggttcgaacccggatcacgacgtccgaccttgcaatttcggcatttgccagttga |
9349788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 16 - 99
Target Start/End: Original strand, 2590845 - 2590928
Alignment:
| Q |
16 |
tcagtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctaga |
99 |
Q |
| |
|
|||||||||||| ||||||||||| |||| | | || ||||||||||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
2590845 |
tcagtgaggtccagggttcgaacccagatcacgatgttcggccttgcaatttcgacattttccagttgagttaggacttataga |
2590928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 100
Target Start/End: Complemental strand, 50729603 - 50729524
Alignment:
| Q |
21 |
gaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||| || ||||||| || |||| | ||||||| |||| |||||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
50729603 |
gaggtctcatgttcgaatccagatcacgacgtctgaccttacaatttcggcatttgtcagttgagctagaacttctagac |
50729524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 100
Target Start/End: Original strand, 50783246 - 50783325
Alignment:
| Q |
21 |
gaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||| || ||||||| || |||| | ||||||| |||| |||||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
50783246 |
gaggtctcatgttcgaatccagatcacgacgtctgaccttacaatttcggcatttgtcagttgagctagaacttctagac |
50783325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 96
Target Start/End: Original strand, 51112541 - 51112588
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
||||| ||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
51112541 |
acgtccggcctagcaatttcggcatttgccagttgagctaggacttct |
51112588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 448922 - 448991
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagcta |
88 |
Q |
| |
|
||||||||| ||||||||| |||||| | ||||| |||||| |||||| |||||||| ||||||||||| |
|
|
| T |
448922 |
gtgaggtcctaggttcgaattcggatcacgacgtccggccttacaattttgacatttgtcagttgagcta |
448991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 3113042 - 3113111
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagcta |
88 |
Q |
| |
|
||||| |||| ||||||||| ||| | | ||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
3113042 |
gtgagatcccgggttcgaactcgggttacgacgtccggccttgcaatttcggcatttgccagttgagcta |
3113111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 100
Target Start/End: Complemental strand, 29750690 - 29750621
Alignment:
| Q |
31 |
gttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| |||| || | ||||| |||||||||||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
29750690 |
gttcgaatccgggtcacgacgtccagccttgcaatttcggcatttgccagttgagttagtacttctagac |
29750621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 31255487 - 31255406
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||| ||| ||||||||||||| || | ||||| || || |||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
31255487 |
gtgaggacccgggttcgaacccgggtcacgacgtccagctttataatttcgacatttgtcagttgagttaggacttctagac |
31255406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 57 - 97
Target Start/End: Original strand, 31305828 - 31305868
Alignment:
| Q |
57 |
ccttgcaatttcgacatttgccagttgagctaggacttcta |
97 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
31305828 |
ccttgcaatttcgacatttgccaattgagctaagacttcta |
31305868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 99
Target Start/End: Complemental strand, 51054770 - 51054702
Alignment:
| Q |
31 |
gttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctaga |
99 |
Q |
| |
|
||||||||||| ||| ||||| | ||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
51054770 |
gttcgaacccgaatcataacgttcgaccttgtaatttcgacatttgtcagttgagttaggacttctaga |
51054702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 96
Target Start/End: Original strand, 14868945 - 14868979
Alignment:
| Q |
62 |
caatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
14868945 |
caatttcggcatttgccagttgagctaggacttct |
14868979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 96
Target Start/End: Complemental strand, 47770367 - 47770329
Alignment:
| Q |
58 |
cttgcaatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47770367 |
cttgcaatttcgacatttatcagttgagctaggacttct |
47770329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 97
Target Start/End: Complemental strand, 53182794 - 53182736
Alignment:
| Q |
39 |
ccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttcta |
97 |
Q |
| |
|
||||||| ||||||||| |||||||||||| ||||||||||||| ||| | ||||||| |
|
|
| T |
53182794 |
ccggatcacaacgtctgaccttgcaatttcagcatttgccagttgtgctcgaacttcta |
53182736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 100
Target Start/End: Original strand, 32001507 - 32001552
Alignment:
| Q |
55 |
ggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||| |||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
32001507 |
ggccttacaatttcggcatttaccagttgaggtaggacttctagac |
32001552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 52 - 99
Target Start/End: Original strand, 44879313 - 44879361
Alignment:
| Q |
52 |
tctggccttgcaatttcgacattt-gccagttgagctaggacttctaga |
99 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
44879313 |
tctggcctaacaatttcgacattttgccagttgaactaggacttctaga |
44879361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 27)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 1191587 - 1191670
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1191587 |
gtgaggtcccgggttcgaacccggatcacgacgtccggccttgcaatttcgtcatttgccagttgagctaggacttctagacaa |
1191670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 13204038 - 13203957
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || | ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
13204038 |
gtgaggtcccgggttcgaacccgggtcacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
13203957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 2971065 - 2970983
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||||| |||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2971065 |
gtgaggtctcaggttcgaacccgggtcacaacgtctgaccttacaatttcgacatttatcagttgagctaggacttctagaca |
2970983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 21018304 - 21018223
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| ||||| ||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
21018304 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggcctcgcaattttggcatttgccagttgagctaggacttctagac |
21018223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 4824986 - 4825066
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctaga |
99 |
Q |
| |
|
|||||||||| |||| ||||| || || ||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4824986 |
gtgaggtcccgggtttgaacctgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
4825066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 20 - 100
Target Start/End: Complemental strand, 12257436 - 12257356
Alignment:
| Q |
20 |
tgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||| ||||||||||| | || |||||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12257436 |
tgaggtcctgggttcgaacccaggtcacaacgtctggccttacaatttcggcatttgccagttgagctaggacttctagac |
12257356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 35317744 - 35317826
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||| ||| | || |||||| | ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35317744 |
gtgaggtcccgggttcgaccccaggtcataacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagaca |
35317826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 21 - 97
Target Start/End: Complemental strand, 6021071 - 6020995
Alignment:
| Q |
21 |
gaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttcta |
97 |
Q |
| |
|
|||||||| |||||||| |||| || ||||||| ||||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
6021071 |
gaggtcccgggttcgaatccgggtcacaacgtcaggccttgcaattttgacatttgccaattgagttaggacttcta |
6020995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 11124703 - 11124651
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11124703 |
acgtccggccttgcaattttgacatttgccagttgagctaggacttctagaca |
11124651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 20 - 100
Target Start/End: Complemental strand, 21112129 - 21112049
Alignment:
| Q |
20 |
tgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||||||||||| | || | |||| || |||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
21112129 |
tgaggtcccaggttcgaacctaggtcacgacgtatgtccttgcaatttcgacatttgtcagctgagctaggacttctagac |
21112049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 30 - 101
Target Start/End: Original strand, 3386958 - 3387029
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||||||||||| | ||||| ||||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
3386958 |
ggttcgaacccggataacgacgtccggccttgcaatttcggcatttgccagttgaactaggacttttagaca |
3387029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 49 - 100
Target Start/End: Original strand, 9577038 - 9577089
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9577038 |
acgtctggccttgcaatttcagcatttgccagttgagctaggacttctagac |
9577089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 47 - 102
Target Start/End: Complemental strand, 40177677 - 40177622
Alignment:
| Q |
47 |
caacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
40177677 |
caacgtccggccttgcaatttcgacatttgtcagttaagctaggacttctagacaa |
40177622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 27721512 - 27721430
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||| ||||||| || | ||||| | | ||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
27721512 |
gtgaggtcccgggttcaaacccgggtcacgacgtccgactttgcaatttcggcattttccagttgagctaggacttctagaca |
27721430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 38 - 100
Target Start/End: Original strand, 32143468 - 32143530
Alignment:
| Q |
38 |
cccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||| || ||||||| ||||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
32143468 |
cccgggtcacaacgtccggccttgcaattttggcatttgccagttgagctatgacttctagac |
32143530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 96
Target Start/End: Complemental strand, 8734077 - 8734000
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
||||||| || |||||||||| | || | ||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
8734077 |
gtgaggttccgggttcgaacctaggtcacgacgtccggccttgcaatttcagcatttgccagttgagctaggacttct |
8734000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 35546014 - 35545931
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||||||||||||||| |||||| | |||| || ||||||||||| |||||| |||||||| ||| |||||||||||| |
|
|
| T |
35546014 |
gtgaggtcccaggttcgaattcggatcacgacgttcggttttgcaatttcggcatttgtcagttgagttagaacttctagacaa |
35545931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 34 - 100
Target Start/End: Complemental strand, 30127960 - 30127894
Alignment:
| Q |
34 |
cgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||| || | | ||| ||||||||||||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
30127960 |
cgaacccgggtcacgatgtccggccttgcaatttcggcatttacaagttgagctaggacttctagac |
30127894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 29265956 - 29265875
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||| |||| || |||| | | ||||| ||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
29265956 |
gtgaggtcccgggttcgaatccgggtcacaacattcgaccttgtaatttcgacattttctagttgagttaggacttctagac |
29265875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 96
Target Start/End: Original strand, 4444938 - 4444972
Alignment:
| Q |
62 |
caatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
4444938 |
caatttcggcatttgccagttgagctaggacttct |
4444972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 99
Target Start/End: Complemental strand, 37940956 - 37940918
Alignment:
| Q |
62 |
caatttcgacattt-gccagttgagctaggacttctaga |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37940956 |
caatttcgacattttgccagttgagctaggacttctaga |
37940918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 2786352 - 2786271
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||||||||| ||| |||||| | |||| | |||| |||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
2786352 |
gtgaggtcccaggtttgaattcggatcacggcgtccgaccttacaatttcggcatttgccaattgaattaggacttctagac |
2786271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 58 - 99
Target Start/End: Original strand, 17984828 - 17984869
Alignment:
| Q |
58 |
cttgcaatttcgacatttgccagttgagctaggacttctaga |
99 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
17984828 |
cttgcaatttcgacctttttcagttgagctaggacttctaga |
17984869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 31909432 - 31909481
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttc |
68 |
Q |
| |
|
|||||||||| ||||||||||||| || |||||||||||||||||||| |
|
|
| T |
31909432 |
gtgaggtcccgggttcgaacccgggtcatgacgtctggccttgcaatttc |
31909481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 56 - 101
Target Start/End: Complemental strand, 38955272 - 38955227
Alignment:
| Q |
56 |
gccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||||||| ||||| | ||||||||||| ||||||||||| |
|
|
| T |
38955272 |
gccttgcaatttcggcatttactagttgagctagaacttctagaca |
38955227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 93
Target Start/End: Original strand, 15206803 - 15206855
Alignment:
| Q |
41 |
ggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggact |
93 |
Q |
| |
|
||||| |||| |||| | ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
15206803 |
ggatcacaacatctgactttgcaatttcggcatttaccagttgagctaggact |
15206855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 100
Target Start/End: Complemental strand, 17465135 - 17465091
Alignment:
| Q |
56 |
gccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||||| ||||||| || ||||||||||||| ||||| |
|
|
| T |
17465135 |
gccttgcaatttcggcatttgctagctgagctaggacttttagac |
17465091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 63; Significance: 2e-27; HSPs: 34)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 32333195 - 32333113
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32333195 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagaca |
32333113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 28817337 - 28817254
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||| |||| ||||||||||||| || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28817337 |
gtgagatcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagacaa |
28817254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 35779544 - 35779625
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| ||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
35779544 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaattttggcatttgccagttgagctaggacttctagac |
35779625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 30 - 100
Target Start/End: Original strand, 12534776 - 12534846
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12534776 |
ggttcgaacccggatcacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
12534846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 6602565 - 6602646
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6602565 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
6602646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 6678018 - 6678099
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6678018 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
6678099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 10963287 - 10963368
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||| ||||| |||||| ||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10963287 |
gtgaggtcccgggttcgaacctggatcacaacgttcggccttgtaatttcggcatttgccagttgagctaggacttctagac |
10963368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 1387 - 1470
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||| |||||||||| || || ||||||| ||||||||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
1387 |
gtgaggtcccgggttcgaaccagggtcacaacgtccggccttgcaattttggcatttgccagttgagctagaacttctagacaa |
1470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 7792742 - 7792661
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||| |||| |||||||||||| || ||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
7792742 |
gtgagatcccgggttcgaacccgagtcacaacgtccagccttgcaatttcggcatttgccagttgagctaggacttctagac |
7792661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 40911301 - 40911221
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || | ||||| ||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
40911301 |
gtgaggtccc-ggttcgaacccgggtcacgacgtccggccttgcaatttcggcatttgccagttgagctagcacttctagac |
40911221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 4531029 - 4531111
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| |||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
4531029 |
gtgaggtcccgggttcgaacccgggtcatgacgtccagccttgcaatttcggcatttgccaattgagctaggacttctagaca |
4531111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 42192686 - 42192768
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||| |||| ||||||||| ||| || ||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42192686 |
gtgagatcccgggttcgaactcgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagaca |
42192768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 70570 - 70651
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||| ||||||| || ||||| | ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
70570 |
gtgaggtcccgggttcaaacccgggtcatgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagac |
70651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 7813403 - 7813322
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||| || |||| || |||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
7813403 |
gtgaggtcccgggttcgaacccgagtcacaacatccggccttgcaatttcagcatttgccggttgagctaggacttctagac |
7813322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 49 - 105
Target Start/End: Complemental strand, 39303360 - 39303304
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaatat |
105 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
39303360 |
acgtccggccttgcaatttcggcatttgccagttgagctaggacttcttgacaatat |
39303304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 58 - 101
Target Start/End: Complemental strand, 22979646 - 22979603
Alignment:
| Q |
58 |
cttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22979646 |
cttgcaatttcgacatttgccagttgagctaggacttctagaca |
22979603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 1078695 - 1078776
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||| || || ||||| ||||||||||||||| ||||| |||||||||||| ||||||||||| |
|
|
| T |
1078695 |
gtgaggtcccgggttcgaacctgggtcatgacgtccggccttgcaatttcggcatttaccagttgagctacgacttctagac |
1078776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 49 - 102
Target Start/End: Complemental strand, 6099623 - 6099570
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
6099623 |
acgtccggccttgcaatttcgacatttgcaagttgaactaggacttctagacaa |
6099570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 47 - 100
Target Start/End: Complemental strand, 9292071 - 9292018
Alignment:
| Q |
47 |
caacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| ||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9292071 |
caacgtccggctttacaatttcgacatttgccagttgagctaggacttctagac |
9292018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 39435363 - 39435282
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||| | ||||||||||| |||| ||||| | ||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
39435363 |
gtgaggtctcgggttcgaacccagatcatgacgtccgaccttgcaattttgacatttgccagttgagctagaacttctagac |
39435282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 31969768 - 31969848
Alignment:
| Q |
20 |
tgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||| ||||||| ||||||||| || ||||| ||||||||||| |
|
|
| T |
31969768 |
tgaggtcccgtgttcgaacccggatcatgacgtctggccttgaaatttcggcatttgccaattaagctatgacttctagac |
31969848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 30 - 101
Target Start/End: Complemental strand, 3822466 - 3822395
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||||||||| || ||||||| | |||| |||||||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
3822466 |
ggttcgaacccgggtcacaacgtccgaccttacaatttcggcatttgccagttgaactagaacttctagaca |
3822395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 58 - 100
Target Start/End: Original strand, 41753066 - 41753108
Alignment:
| Q |
58 |
cttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41753066 |
cttgcaatttcgacatttgtcagttgagctaggacttctagac |
41753108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 48 - 102
Target Start/End: Original strand, 42364777 - 42364831
Alignment:
| Q |
48 |
aacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||| ||||||||||| |||||| |||||||| |||||||||||||||| |
|
|
| T |
42364777 |
aacgtctggctttgcaatttcggcatttggcagttgagataggacttctagacaa |
42364831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 29425408 - 29425356
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||| ||||||||||||| | ||||||||| ||||||||||||||||||||| |
|
|
| T |
29425408 |
acgtccggccttgcaattttggcatttgccaattgagctaggacttctagaca |
29425356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 31695316 - 31695399
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||||||||||||||| ||| ||| || || ||||||||||| ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
31695316 |
gtgaggtcccaggttcgaatccgaatcatgacatccaaccttgcaattttgacatgtgccagttgagctagaacttctagacaa |
31695399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 45264687 - 45264768
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| |||||||||||| || | |||| | ||| ||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
45264687 |
gtgaggtcccgggttcgaacccgagtcacgacgttcgacct-gcaatttcggcatttgccagttgagttaggacttctagaca |
45264768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 18386789 - 18386704
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaata |
104 |
Q |
| |
|
|||||||||| |||||||||||| || || || | |||||||||||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
18386789 |
gtgaggtcccgggttcgaacccgagtcatgacatccgaccttgcaatttcagcatttgtcagttgagctagaacttctagacaata |
18386704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 101
Target Start/End: Original strand, 41849276 - 41849360
Alignment:
| Q |
17 |
cagtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||||| || | ||||||||| |||| | ||||| | ||||||||||||| |||||||||||||| || |||||| ||||| |
|
|
| T |
41849276 |
cagtgaggttccggattcgaacccagatcacgacgtccgaccttgcaatttcggcatttgccagttgaattaagacttccagaca |
41849360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 100
Target Start/End: Complemental strand, 20269601 - 20269542
Alignment:
| Q |
41 |
ggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||| ||||||| |||||| |||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
20269601 |
ggatcacaacgtccggccttacaatttcggtatttgccagttgagctaagacttttagac |
20269542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 41 - 100
Target Start/End: Complemental strand, 21056230 - 21056171
Alignment:
| Q |
41 |
ggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||| ||||||| |||||| |||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
21056230 |
ggatcacaacgtccggccttacaatttcggtatttgccagttgagctaagacttttagac |
21056171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 82
Target Start/End: Complemental strand, 42885255 - 42885192
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagtt |
82 |
Q |
| |
|
||||| |||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||| |
|
|
| T |
42885255 |
gtgagatcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagtt |
42885192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 99
Target Start/End: Complemental strand, 10096650 - 10096612
Alignment:
| Q |
62 |
caatttcgacattt-gccagttgagctaggacttctaga |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
10096650 |
caatttcgacattttgccagttgagctaggacttctaga |
10096612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 31532172 - 31532225
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgaca |
72 |
Q |
| |
|
|||||||||| ||||| || |||| || ||||||| |||||||||||||||||| |
|
|
| T |
31532172 |
gtgaggtccccggttcaaatccgggtcacaacgtccggccttgcaatttcgaca |
31532225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 13998 - 14079
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13998 |
gtgaggtcccgggttcgaacccggatcacaacgtccggccttgcaatttcggtatttgccagttgagctaggacttctagac |
14079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 19678 - 19759
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19678 |
gtgaggtcccgggttcgaacccggatcacaacgtccggccttgcaatttcggtatttgccagttgagctaggacttctagac |
19759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 62; Significance: 6e-27; HSPs: 35)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 19849550 - 19849631
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19849550 |
gtgaggtcccgggttcgaacccggatcacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
19849631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 32441131 - 32441212
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32441131 |
gtgaggtcccgggttcgaacccgggtcatgatgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
32441212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 18257410 - 18257328
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| || ||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
18257410 |
gtgaggtcccgggctcgaacccggatcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagaca |
18257328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 34739361 - 34739280
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34739361 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
34739280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 45874136 - 45874055
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| ||||||||||||| | |||||| ||||||||||||||||||||||| |
|
|
| T |
45874136 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaattttggcatttgtcagttgagctaggacttctagac |
45874055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 22 - 102
Target Start/End: Original strand, 28798438 - 28798518
Alignment:
| Q |
22 |
aggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||| ||||||||||||| || | ||||| ||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
28798438 |
aggtcccgggttcgaacccgggtcacgacgtccggccttgcaatttcggcatttgccagttgaactaggacttctagacaa |
28798518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 1174032 - 1173950
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||| | || ||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1174032 |
gtgaggtcccgggttcgaacccaggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagaca |
1173950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 97
Target Start/End: Complemental strand, 22608066 - 22607988
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttcta |
97 |
Q |
| |
|
|||||||||| ||||||||||||| || | ||||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
22608066 |
gtgaggtcccgggttcgaacccgggtcacgacgtccggccttgcaatttcgacatctgtcagttgagctaggacttcta |
22607988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 53457905 - 53457819
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaatat |
105 |
Q |
| |
|
|||||||||| | ||||||||||| || ||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53457905 |
gtgaggtcccggattcgaacccgggtcatgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagacaatat |
53457819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 20 - 97
Target Start/End: Complemental strand, 3465832 - 3465755
Alignment:
| Q |
20 |
tgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttcta |
97 |
Q |
| |
|
||||||||| ||||||||| ||||| ||||||| |||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
3465832 |
tgaggtcccgagttcgaacctggatcacaacgtccggccttgcaatttcgatatttgctagttgagctaggacttcta |
3465755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 23710380 - 23710461
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| ||||||||||| |||| || | ||||| ||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
23710380 |
gtgaggttccaggttcgaatccgggtcacgacgtccggccttgcaatttcgacatttaccagttgagctatgacttctagac |
23710461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 43139953 - 43140034
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
43139953 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctagaacttctagac |
43140034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 54768479 - 54768560
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54768479 |
gtgaggtcctgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
54768560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 19673976 - 19674060
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
|||||||||| ||||||||||| | || |||||| |||||||||||||| |||||| |||||||||||| |||||||||||||| |
|
|
| T |
19673976 |
gtgaggtcccgggttcgaacccaggtcacaacgttcggccttgcaatttctacatttaccagttgagctaagacttctagacaat |
19674060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 19225340 - 19225261
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctag |
98 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| ||| || |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19225340 |
gtgaggtcccgggttcgaacccggatcatgacgtccggctttacaatttcggcatttgccagttgagctaggacttctag |
19225261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 11278063 - 11277981
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| |||| |||||||| || | ||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11278063 |
gtgaggtcccgggtttgaacccgggtcatgatgtccggccttgcaatttcggcatttgccagttgagctaggacttctagaca |
11277981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 12735512 - 12735430
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||||| ||||||||||||| || |||||||||||||| |||||| | |||||| |||||||||||| ||||||||||| |
|
|
| T |
12735512 |
gtgaggtcctgggttcgaacccgggtcacaacgtctggccttacaattttggcatttgtcagttgagctagtacttctagaca |
12735430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 26424905 - 26424985
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| | ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26424905 |
gtgaggtcccgggttcgaacccgggtcatgacgtccg-ccttgcaatttcggcatttgccagttgagctaggacttctagac |
26424985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 24 - 92
Target Start/End: Original strand, 23417535 - 23417603
Alignment:
| Q |
24 |
gtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggac |
92 |
Q |
| |
|
||||| ||||||||||||| || ||||||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
23417535 |
gtcccgggttcgaacccgggtcacaacgtccggccttgcaattttggcatttgccagttgagctaggac |
23417603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 12867922 - 12867840
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||| |||||||||||||| ||| || | ||||| | ||||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
12867922 |
gtgagatcccaggttcgaactcgggtcacgacgtccgaccttgcaatttcggcatttgacagttgagctagaacttctagaca |
12867840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 55214733 - 55214652
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || | ||||| ||||||||||||| | |||||| |||||||| || ||||||||||| |
|
|
| T |
55214733 |
gtgaggtcccgggttcgaacccgggtcacgacgtccggccttgcaattttggcatttgacagttgagttaagacttctagac |
55214652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 2864796 - 2864876
Alignment:
| Q |
20 |
tgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||| | |||||||||||||| || | ||||| |||||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
2864796 |
tgaggttctaggttcgaacccgggtcacgacgtcccgccttgcaatttaggcatttgccagttgagttaggacttctagac |
2864876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 19814186 - 19814102
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
||||||||||||||| |||||| | || | ||||| |||||| ||||||| |||||||||||||||||| |||||||| ||||| |
|
|
| T |
19814186 |
gtgaggtcccaggtttgaacccaggtcacgacgtccggccttacaatttctgcatttgccagttgagctaagacttctaaacaat |
19814102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 238505 - 238587
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||| | || |||| |||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
238505 |
gtgaggtcccgggttcgaacccaggtcatggcgtccagccttgcaatttcggcatttgacagttgagctaggacttctagaca |
238587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 22910304 - 22910385
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||| |||||||||||||||||| || | ||||| | ||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
22910304 |
gtgagatcccaggttcgaacccgggtcacgacgtccgaccttgcaatttcgacttttgtcagttgagcggagacttctagac |
22910385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 22968218 - 22968137
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||| |||||||||||||||||| || | ||||| | ||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
22968218 |
gtgagatcccaggttcgaacccgggtcacgacgtccgaccttgcaatttcgacttttgtcagttgagcggagacttctagac |
22968137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 101
Target Start/End: Original strand, 49030796 - 49030863
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||||| |||||| | ||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49030796 |
ggttcgaactcggatcacgacgtccggccttgcaatttcgacatttgcca----tgctaggacttctagaca |
49030863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 93
Target Start/End: Original strand, 52172037 - 52172111
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggact |
93 |
Q |
| |
|
||||||| | |||||| |||||| ||| | |||||||||||| |||||| ||||||||||| ||||||| ||||| |
|
|
| T |
52172037 |
gtgaggttctaggttcaaacccgaatcacgacgtctggccttacaattttgacatttgccaattgagcttggact |
52172111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 100
Target Start/End: Complemental strand, 55400297 - 55400228
Alignment:
| Q |
31 |
gttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| ||||||| ||||| ||||||||||||||| ||||| ||||||||| ||||| |||||||| |
|
|
| T |
55400297 |
gttcgaatccggatcatgacgtccggccttgcaatttcggcatttaccagttgagttaggatttctagac |
55400228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 29581090 - 29581174
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
|||||||| | |||||||||| | || | ||||| ||||||||||||||| ||| || || |||||||||||||||| |||||| |
|
|
| T |
29581090 |
gtgaggtctcgggttcgaacctaggtcacgacgtccggccttgcaatttcggcatctgacaattgagctaggacttcttgacaat |
29581174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 101
Target Start/End: Complemental strand, 12767125 - 12767086
Alignment:
| Q |
62 |
caatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
12767125 |
caatttcggcatttaccagttgagctaggacttctagaca |
12767086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 102
Target Start/End: Complemental strand, 23532118 - 23532071
Alignment:
| Q |
55 |
ggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| |||| ||||||| |
|
|
| T |
23532118 |
ggccttgcaatttcgacatttgtcagttgagttagaacttttagacaa |
23532071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 97
Target Start/End: Complemental strand, 23858547 - 23858481
Alignment:
| Q |
31 |
gttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttcta |
97 |
Q |
| |
|
||||||||||||||| |||| | |||||| |||||| ||||||| |||||||||||||| ||||| |
|
|
| T |
23858547 |
gttcgaacccggatcacaacttacggccttacaattttaacatttgtcagttgagctaggaattcta |
23858481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 37134118 - 37134048
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||||||| || || | ||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
37134118 |
ggttcgaacccggatcatgacatccgaccttgtaatttcagcatttgccagttgaactaggacttctagac |
37134048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 105
Target Start/End: Complemental strand, 19119195 - 19119139
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaatat |
105 |
Q |
| |
|
||||| ||||||| ||||| ||||||| ||||||| ||| |||||||||||||||| |
|
|
| T |
19119195 |
acgtccggccttgtaattttgacatttatcagttgaactaagacttctagacaatat |
19119139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 34)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 26605705 - 26605624
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26605705 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
26605624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 19537388 - 19537306
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||| || |||||||||||||||| ||||||| ||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
19537388 |
gtgaggttccgggttcgaacccggatcacaacgtccggccttgcaatttcggcatttgccagttgaactaggacttctagaca |
19537306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 10639653 - 10639735
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10639653 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagaca |
10639735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 11708759 - 11708677
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||||| ||||||||||||| || ||||||| |||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11708759 |
gtgaggtcctgggttcgaacccgggtcacaacgtccggccttacaatttcggcatttgccagttgagctaggacttctagaca |
11708677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 39535581 - 39535663
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| || | ||||| ||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
39535581 |
gtgaggtcccgggttcgaacccgggtcacgacgtccggccttgcaatttcgacatttgctagttgagttaggacttctagaca |
39535663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 19048835 - 19048754
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| |||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19048835 |
gtgaggtcccgggttcgaacccggatcatgacgtccggccttacaatttcggcatttgccagttgagctaggacttctagac |
19048754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 23839940 - 23839859
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||||||||||||| | || ||||||| ||||||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
23839940 |
gtgaggtcccaggttcgaacccaggtcacaacgtccggccttgcaattttggcatttgccagttgagttaggacttctagac |
23839859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 33083601 - 33083682
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33083601 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
33083682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 21 - 105
Target Start/End: Complemental strand, 19816299 - 19816215
Alignment:
| Q |
21 |
gaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaatat |
105 |
Q |
| |
|
||||| || ||||| ||||||| || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19816299 |
gaggttccgggttcaaacccgggtcacaacgtccggccttgcaatttcggtatttgccagttgagctaggacttctagacaatat |
19816215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 30 - 102
Target Start/End: Complemental strand, 34460439 - 34460367
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||||||||| || ||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
34460439 |
ggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgtcagttgagctaggacttctagacaa |
34460367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 11459796 - 11459714
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| | ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11459796 |
gtgaggtcccgggttcgaacccgggtcatgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagaca |
11459714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 39831491 - 39831571
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
39831491 |
gtgaggtccc-ggttcgaacccggatcatgacgtccggccttgcaatttcggtatttgccagttgagctaggacttatagac |
39831571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 11816598 - 11816680
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||| || ||||||||||| | || | ||||| | ||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
11816598 |
gtgaggttccgggttcgaacccaggtcacgacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctggaca |
11816680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 47 - 101
Target Start/End: Original strand, 45125240 - 45125294
Alignment:
| Q |
47 |
caacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||| |||||| |||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45125240 |
caacgtccggccttacaatttcggcatttgccagttgagctaggacttctagaca |
45125294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 104
Target Start/End: Complemental strand, 4851401 - 4851316
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaata |
104 |
Q |
| |
|
|||||||||| |||| ||||||||||| | ||||| ||| || |||||||| || ||| |||||||||||||||||| |||||||| |
|
|
| T |
4851401 |
gtgaggtcccgggtttgaacccggatcacgacgtccggctttacaatttcggcaattgacagttgagctaggacttcaagacaata |
4851316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 37197657 - 37197726
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagcta |
88 |
Q |
| |
|
|||||||||| ||||||||||||| || | ||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
37197657 |
gtgaggtcccgggttcgaacccgggtcacgacgtccagccttgcaatttcggcatttgccagttgagcta |
37197726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 100
Target Start/End: Complemental strand, 34234610 - 34234530
Alignment:
| Q |
20 |
tgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| | ||||| ||| | |||| |||| || | ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34234610 |
tgaggtctcgggttcaaactcagatcacaacatccgaccttgcaatttcggcatttgccagttgagctaggacttctagac |
34234530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 21312286 - 21312211
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggactt |
94 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||||||| || ||| |||||| ||||||||||| ||||||||| |||| |
|
|
| T |
21312286 |
gtgaggtcccaggttcgatcccagatcacaacgtccggtcttacaattttgacatttgccaattgagctagaactt |
21312211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 30 - 101
Target Start/End: Original strand, 29659276 - 29659347
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||||||||| || ||| || |||||| |||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
29659276 |
ggttcgaacccgggtcacaatgttcggccttacaattttggcatttgccagttgagctaggacttctagaca |
29659347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 57 - 100
Target Start/End: Complemental strand, 42578223 - 42578180
Alignment:
| Q |
57 |
ccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42578223 |
ccttgcaatttcggcatttgccagttgagctaggacttctagac |
42578180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 16654444 - 16654360
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
||||||| || ||||||||| |||||| | |||| ||||||||||||||| ||||| |||||||| ||||||||||| ||||| |
|
|
| T |
16654444 |
gtgaggttccgggttcgaactcggatcacggcgtccggccttgcaatttcggcatttatcagttgagttaggacttctaaacaat |
16654360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 56 - 103
Target Start/End: Complemental strand, 4800920 - 4800873
Alignment:
| Q |
56 |
gccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| ||||| |
|
|
| T |
4800920 |
gccttgcaatttcgacatttgccggttgagctagaacttctaaacaat |
4800873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 49 - 96
Target Start/End: Original strand, 25501860 - 25501907
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25501860 |
acgtccggccttgcaatttcagcatttgccagttgagctaggacttct |
25501907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 100
Target Start/End: Original strand, 40786266 - 40786337
Alignment:
| Q |
29 |
aggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||||| || || | ||||| ||||||||||||||| |||||| |||||||| || ||||||||||| |
|
|
| T |
40786266 |
aggttcgaaccagggtcacgacgtccggccttgcaatttcggcatttgtcagttgagttatgacttctagac |
40786337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 21 - 103
Target Start/End: Original strand, 38440246 - 38440328
Alignment:
| Q |
21 |
gaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
|||||| |||||||| | |||| || | ||||| ||||||||||||||| |||||| |||||||||| | ||||||| ||||| |
|
|
| T |
38440246 |
gaggtctcaggttcggatccgggtcacgacgtccggccttgcaatttcggcatttgtcagttgagctggaacttctaaacaat |
38440328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 7349179 - 7349098
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||| | | ||||||| |||||| | ||||| ||||||||||| || ||||||||||||||| | |||||||||||| |
|
|
| T |
7349179 |
gtgaggtctcggattcgaactcggatcacgacgtccggccttgcaatatcagcatttgccagttgagattggacttctagac |
7349098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 61 - 102
Target Start/End: Complemental strand, 13106395 - 13106354
Alignment:
| Q |
61 |
gcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
13106395 |
gcaattttgacatttaccagttgagctaggacttctagacaa |
13106354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 100
Target Start/End: Original strand, 45201931 - 45202000
Alignment:
| Q |
31 |
gttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||| |||||| | ||| | | |||| |||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
45201931 |
gttcgaactcggatcacgacgaccgaccttacaatttcgacatttgccaattgagttaggacttctagac |
45202000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 7275933 - 7276016
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacattt-gccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| | | || || | ||||||||||||| ||||| | |||||||| ||||||||||||||| |
|
|
| T |
7275933 |
gtgaggtcccgggttcgaacccgggccacgacatccgaccttgcaatttcggcattttgtcagttgagttaggacttctagaca |
7276016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 101
Target Start/End: Original strand, 14308818 - 14308864
Alignment:
| Q |
55 |
ggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||| ||||||||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
14308818 |
ggccttacaatttcgacaattgtcagtttagctaggacttctagaca |
14308864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 96
Target Start/End: Original strand, 21840539 - 21840573
Alignment:
| Q |
62 |
caatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21840539 |
caatttcgacatttgtcagttgagctaggacttct |
21840573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 63 - 96
Target Start/End: Complemental strand, 42025707 - 42025674
Alignment:
| Q |
63 |
aatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
42025707 |
aatttcgacatttgtcagttgagctaggacttct |
42025674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 96
Target Start/End: Complemental strand, 43684114 - 43684073
Alignment:
| Q |
55 |
ggccttgcaatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
43684114 |
ggccttgcaatttcggcatttgtcagttgagataggacttct |
43684073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 97
Target Start/End: Original strand, 32844654 - 32844702
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttcta |
97 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||| ||| ||||||| |
|
|
| T |
32844654 |
acgtccggccttgcaatttcggcatttgccagttgaactaaaacttcta |
32844702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 28)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 28455955 - 28455874
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28455955 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
28455874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 29994430 - 29994511
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||| | |||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29994430 |
gtgaggtctcgggttcgaacccggatcatgacgtctggccttgcaatttcggcatttgccagttgagctaggacttctagac |
29994511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 41761458 - 41761541
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||||| ||||||||||||| || ||||||| ||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
41761458 |
gtgaggtcctgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgaactaggacttctagacaa |
41761541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 48660103 - 48660020
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||| |||| ||||||||||||| || |||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48660103 |
gtgagatcccgggttcgaacccgggtcataacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagacaa |
48660020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 19 - 93
Target Start/End: Complemental strand, 39276431 - 39276357
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggact |
93 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39276431 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaatttcggcatttgccagttgagctaggact |
39276357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 32007155 - 32007074
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32007155 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
32007074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 19 - 97
Target Start/End: Complemental strand, 29587333 - 29587255
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttcta |
97 |
Q |
| |
|
|||||||||| ||||||||||| | || | ||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
29587333 |
gtgaggtcccgggttcgaacccaggtcacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttcta |
29587255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 5055835 - 5055916
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
5055835 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagctgagctaggacttctagac |
5055916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 41808283 - 41808202
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| || ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41808283 |
gtgaggttccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
41808202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 45813058 - 45813140
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| || | | ||| | ||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
45813058 |
gtgaggtcccgggttcgaacccgggtcacgatgtccgaccttgcaatttcggcatttgtcagttgagctaggacttctagaca |
45813140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 192496 - 192415
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||| ||||||||| |||||| ||||||| ||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
192496 |
gtgaggtcctgggttcgaacacggatcacaacgtccggccttgcaattttagcatttgtcagttgagctaggacttctagac |
192415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 46447424 - 46447506
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| | | ||||| |||||||||||||| |||||||||||||| |||| ||||||||||| |
|
|
| T |
46447424 |
gtgaggtcccgggttcgaacccgggttacgacgtcgagccttgcaatttcggcatttgccagttgaactagaacttctagaca |
46447506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 20829 - 20748
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||| |||| || | |||| |||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
20829 |
gtgaggtcccgggttcgaatccgggtcacggcgtcctgccttgcaatttcggcatttgccagttgagttaggacttctagac |
20748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 99
Target Start/End: Complemental strand, 5943750 - 5943682
Alignment:
| Q |
31 |
gttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctaga |
99 |
Q |
| |
|
|||||||||||| || | ||||| ||||||||||||||| |||||| |||||||||||||| ||||||| |
|
|
| T |
5943750 |
gttcgaacccgggtcacgacgtccggccttgcaatttcggcatttgtcagttgagctaggaattctaga |
5943682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 35945878 - 35945798
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctaga |
99 |
Q |
| |
|
||||||| || ||||||||||| | || ||||||| ||||| |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
35945878 |
gtgaggttccgggttcgaacccaggtcacaacgtccagccttacaatttcggcatttaccagttgagctaggacttctaga |
35945798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 50106243 - 50106325
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| || |||||| ||||||||||| || |||||| |||||| | ||||||||||||||| |
|
|
| T |
50106243 |
gtgaggtcccgggttcgaacccgggtcacaacgttcggccttgcaatctcaacatttaccagttaaattaggacttctagaca |
50106325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 100
Target Start/End: Original strand, 2088964 - 2089033
Alignment:
| Q |
31 |
gttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||||| || | | ||||| |||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2088964 |
gttcgaacccgagtcacgatgtctgaccttacaatttcgatatttgccagttgagctaggacttctagac |
2089033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 100
Target Start/End: Complemental strand, 11688331 - 11688263
Alignment:
| Q |
32 |
ttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||| || || |||||| || ||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
11688331 |
ttcgaaccagggtcacaacgttcgggcttgcaatttcgatatttgtcagttgagctaggacttctagac |
11688263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 58 - 102
Target Start/End: Complemental strand, 45294700 - 45294656
Alignment:
| Q |
58 |
cttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
45294700 |
cttgcaatttcggcatttgctagttgagctaggacttctagacaa |
45294656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 101
Target Start/End: Complemental strand, 4066039 - 4065960
Alignment:
| Q |
22 |
aggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||| ||| |||||||||||||| |||||| | |||||||||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
4066039 |
aggtctcagattcgaacccggatcacaacgttcagtcttgcaatttcggtatttgtcagttgagctaggtcttctagaca |
4065960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 49783788 - 49783705
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||| || |||||||||||| ||| |||| | ||||||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
49783788 |
gtgaggttccgggttcgaacccgaatcatgacgttcgaccttgcaatttcgacatttgccaattgagttaggacttatagacaa |
49783705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 39284371 - 39284289
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||| ||||||||||||| ||| | ||||| | |||| ||||||| ||||| | ||||||||||| |||||||||||| |
|
|
| T |
39284371 |
gtgaggtcttaggttcgaacccgaatcacgacgtccgaccttacaatttcaacattcgtcagttgagctatgacttctagaca |
39284289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 21938987 - 21938944
Alignment:
| Q |
55 |
ggccttgcaatttcgacatttgccagttgagctaggacttctag |
98 |
Q |
| |
|
|||||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
21938987 |
ggccttacaatttcggcatttaccagttgagctaggacttctag |
21938944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 49 - 100
Target Start/End: Original strand, 25931226 - 25931277
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||| |||||||||||||| |||||| |||||||| ||||| |||||||| |
|
|
| T |
25931226 |
acgtctagccttgcaatttcggcatttgtcagttgagttaggatttctagac |
25931277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 102
Target Start/End: Original strand, 34121643 - 34121686
Alignment:
| Q |
59 |
ttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
34121643 |
ttgcaatttcgacatttgccagttgaattaggacttcaagacaa |
34121686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 76
Target Start/End: Complemental strand, 7059548 - 7059491
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttg |
76 |
Q |
| |
|
|||||||| ||| ||||||||||| || | ||||||| ||||||||||| |||||||| |
|
|
| T |
7059548 |
gtgaggtctcagattcgaacccgggtcacgacgtctgaccttgcaattttgacatttg |
7059491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 48 - 101
Target Start/End: Complemental strand, 7275733 - 7275680
Alignment:
| Q |
48 |
aacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||| | |||| |||||||||||||||||||||||| || || ||||||||| |
|
|
| T |
7275733 |
aacgtccgaccttacaatttcgacatttgccagttgagttaagatttctagaca |
7275680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 102
Target Start/End: Original strand, 32982432 - 32982480
Alignment:
| Q |
54 |
tggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||| || ||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
32982432 |
tggccttacagtttcggcatttatcagttgagctaggacttctagacaa |
32982480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 4e-25; HSPs: 37)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 44084021 - 44083939
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| ||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
44084021 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaattttggcatttgccagttgagctaggacttctagaca |
44083939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 40058319 - 40058238
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| ||||||||||||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
40058319 |
gtgaggtcccgggttcgaacccgggtcacaacgtccggccttgcaattttggcatttgccagttgagttaggacttctagac |
40058238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 30 - 102
Target Start/End: Complemental strand, 2146706 - 2146634
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||||||||| || ||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
2146706 |
ggttcgaacccgggtcacaacgtccggccttgcaatttcggcattttccagttgagctaggacttctagacaa |
2146634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 31770579 - 31770663
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaat |
103 |
Q |
| |
|
|||||||||| ||||||||||||| || || || ||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31770579 |
gtgaggtcccgggttcgaacccgggtcatgacatccggccttgcaatttcggcatttgccagttgagctaggacttctagacaat |
31770663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 23358266 - 23358183
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||| ||||||||||||| | | ||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
23358266 |
gtgaggtcccgggttcgaacccgggttacgacgtccggccttgcaatttcggtatttgccagttgagctaggacttctagacaa |
23358183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 25 - 99
Target Start/End: Original strand, 47250304 - 47250378
Alignment:
| Q |
25 |
tcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctaga |
99 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47250304 |
tcccaggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctaga |
47250378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 4106819 - 4106738
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
4106819 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgggctaggacttctagac |
4106738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 7162835 - 7162916
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||| || ||||||| |||||| |||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
7162835 |
gtgaggtcccgagttcgaacccgggtcacaacgtccggccttacaatttcggcatttgccagttgagctaggacttttagac |
7162916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 25546322 - 25546404
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| | ||||||||||| || ||||| ||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
25546322 |
gtgaggtcccggattcgaacccgggtcatgacgtccggccttgcaatttcggcatttaccagttgagctaggacttctagaca |
25546404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 27 - 99
Target Start/End: Original strand, 42081671 - 42081743
Alignment:
| Q |
27 |
ccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctaga |
99 |
Q |
| |
|
||||||||||||||||||| |||||| | |||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
42081671 |
ccaggttcgaacccggatcacaacgttcgatcttgcaattttgacatttgccagctgagctaggacttctaga |
42081743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 25112294 - 25112377
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||| ||||||||||| | || ||||| | ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25112294 |
gtgaggtcccgggttcgaacccaggtcatgacgtccgaccttgcaatttcggtatttgccagttgagctaggacttctagacaa |
25112377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 27229525 - 27229600
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggactt |
94 |
Q |
| |
|
|||||||||| ||||||||||| | || | ||||| |||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
27229525 |
gtgaggtcccgggttcgaacccaggtcacgacgtccggccttgcaatttcgacatttgtcagttgagttaggactt |
27229600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 30 - 101
Target Start/End: Complemental strand, 40643044 - 40642973
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||| ||||||||||| ||| |||||||||| ||||||||||||||| ||||||||||| || ||||||||| |
|
|
| T |
40643044 |
ggtttgaacccggatcacaatgtctggccttacaatttcgacatttgtcagttgagctaagatttctagaca |
40642973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 85
Target Start/End: Complemental strand, 4107390 - 4107324
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgag |
85 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
4107390 |
gtgaggtcccgggttcgaacccgggtcgtgacgtccggccttgcaatttcggcatttgccagttgag |
4107324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 93
Target Start/End: Original strand, 29484802 - 29484876
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggact |
93 |
Q |
| |
|
|||||||||| ||||| ||||| |||| ||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29484802 |
gtgaggtcccgggttcaaacccagatcatgacgtccggccttgcaatttcggcatttgccagttgagctaggact |
29484876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 96
Target Start/End: Original strand, 43753801 - 43753878
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
||||||| || ||||||||||| | || | ||||| ||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
43753801 |
gtgaggttccgggttcgaacccaggtcacgacgtccggccttgcaatttcggcatttgccagttgaactaggacttct |
43753878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 8439159 - 8439076
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||||| |||||||| |||| || ||||||| | ||||||||||| | |||||||||||||| |||||||||||| |||| |
|
|
| T |
8439159 |
gtgaggtcctgggttcgaatccgggtcacaacgtccgaccttgcaattttggcatttgccagttgaactaggacttctaaacaa |
8439076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 57 - 100
Target Start/End: Complemental strand, 34763497 - 34763454
Alignment:
| Q |
57 |
ccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34763497 |
ccttgcaatttcgacattttccagttgagctaggacttctagac |
34763454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 30 - 100
Target Start/End: Complemental strand, 29255787 - 29255717
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||||||| | ||||| ||||||||||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
29255787 |
ggttcgaacccggatcacgacgtccaaccttgcaattttggcatttgccagttgagctagaacttctagac |
29255717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 38033810 - 38033728
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||| | || ||||||||||| ||| ||| | |||| |||||||| ||||||||||||||| ||| ||||||||||| |
|
|
| T |
38033810 |
gtgaggtcccggatttgaacccggatcacaatgtccgaccttacaatttcggcatttgccagttgagttagaacttctagaca |
38033728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 89
Target Start/End: Complemental strand, 5587361 - 5587291
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctag |
89 |
Q |
| |
|
||||||||| |||||||||||||||| | | ||| || |||||||||||| |||||| |||||||||||| |
|
|
| T |
5587361 |
gtgaggtcctgggttcgaacccggatcacgatgtccggacttgcaatttcggcatttgtcagttgagctag |
5587291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 89
Target Start/End: Complemental strand, 5592322 - 5592252
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctag |
89 |
Q |
| |
|
||||||||| |||||||||||||||| | | ||| || |||||||||||| |||||| |||||||||||| |
|
|
| T |
5592322 |
gtgaggtcctgggttcgaacccggatcacgatgtccggacttgcaatttcggcatttgtcagttgagctag |
5592252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 22 - 100
Target Start/End: Complemental strand, 43203384 - 43203306
Alignment:
| Q |
22 |
aggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| ||||||||||||| || | |||| ||||| |||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
43203384 |
aggtcccgggttcgaacccgggtcacggcgtcccgccttacaatttcggcatttgccagttcatctaggacttctagac |
43203306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 31 - 100
Target Start/End: Original strand, 5772878 - 5772947
Alignment:
| Q |
31 |
gttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||| || || ||| | ||||||||||||| |||||||| ||||||||| ||||||||||| |
|
|
| T |
5772878 |
gttcgaacccgggtcacattgtccgaccttgcaatttcggcatttgcccgttgagctaagacttctagac |
5772947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 102
Target Start/End: Original strand, 47961004 - 47961085
Alignment:
| Q |
21 |
gaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||| ||||||||||||| || ||||||| ||||| ||||| | ||||||| ||||||| || ||||||||||||| |
|
|
| T |
47961004 |
gaggtcccgggttcgaacccggttcatgacgtctgaccttgtaattttggcatttgcaagttgagttaagacttctagacaa |
47961085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 58 - 102
Target Start/End: Original strand, 28111017 - 28111061
Alignment:
| Q |
58 |
cttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||||||||||||||| |||||||| || ||||||||||||| |
|
|
| T |
28111017 |
cttgcaatttcgacatttgtcagttgagttaagacttctagacaa |
28111061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 102
Target Start/End: Original strand, 32606388 - 32606460
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||| || || | ||||| ||||||||||||||| ||||| |||||||| ||| |||||||||||| |
|
|
| T |
32606388 |
ggttcgaacctgggtcacgacgtccggccttgcaatttcggtatttgtcagttgagttagaacttctagacaa |
32606460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 49 - 101
Target Start/End: Original strand, 43171016 - 43171068
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||| ||||||||||||||| |||||| |||||||| |||||||| |||||| |
|
|
| T |
43171016 |
acgtccggccttgcaatttcggcatttgtcagttgagttaggacttatagaca |
43171068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 99
Target Start/End: Complemental strand, 48146834 - 48146754
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctaga |
99 |
Q |
| |
|
|||||||||| ||||||||||||| || | || |||| |||||||||||| ||||| |||||||||||| || |||||| |
|
|
| T |
48146834 |
gtgaggtcccgggttcgaacccgggtcacgacatctgaccttgcaatttctgcatttttcagttgagctagaacctctaga |
48146754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 102
Target Start/End: Original strand, 48444210 - 48444282
Alignment:
| Q |
30 |
ggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||||||| |||| | ||||| | ||| |||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
48444210 |
ggttcgaacccagatcacgacgtccagtcttacaatttcggcatttttcagttgagctaggacttctagacaa |
48444282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 21 - 100
Target Start/End: Original strand, 4001891 - 4001970
Alignment:
| Q |
21 |
gaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||| |||||||||||| || | || || ||||||||||||||||||||| ||||||| ||| ||| ||||||| |
|
|
| T |
4001891 |
gaggtcccgagttcgaacccgggtcacgacatccggccttgcaatttcgacattttccagttgtactatgacatctagac |
4001970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 29 - 100
Target Start/End: Complemental strand, 25872834 - 25872763
Alignment:
| Q |
29 |
aggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||||| ||||| | ||||| | ||||| ||| ||| ||||||||| ||||| |||||||||||||| |
|
|
| T |
25872834 |
aggttcgaacctggatcacgacgtccgaccttgtaatatcggcatttgccaattgagttaggacttctagac |
25872763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 97
Target Start/End: Complemental strand, 13887252 - 13887174
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttcta |
97 |
Q |
| |
|
||||||| || |||||||||| || || | ||||| || ||||||| |||| ||||||||||||||| || |||||||| |
|
|
| T |
13887252 |
gtgaggttccgggttcgaacctgggtcacgacgtccggtcttgcaagttcggcatttgccagttgagttaagacttcta |
13887174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 11355904 - 11355823
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||| |||| |||||||| || |||| |||||| | ||||||||||||| |||||| |||||| |||| |||||||||| |
|
|
| T |
11355904 |
gtgagatcccgggttcgaatccagatcataacgtccgaccttgcaatttcggcatttgttagttgaactagaacttctagac |
11355823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 47557862 - 47557781
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||| || ||||||||||||| || |||| | ||||| ||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
47557862 |
gtgaggttccgggttcgaacccgggtcatgacgtgcgaccttgtaatttcggcatttaccagttgagttaggacttctagac |
47557781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 57 - 101
Target Start/End: Original strand, 27915666 - 27915710
Alignment:
| Q |
57 |
ccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
|||||||||||| ||||| ||||||||| ||||||||||||||| |
|
|
| T |
27915666 |
ccttgcaatttcagcatttaccagttgagttaggacttctagaca |
27915710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 105
Target Start/End: Complemental strand, 34708699 - 34708667
Alignment:
| Q |
73 |
tttgccagttgagctaggacttctagacaatat |
105 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
34708699 |
tttgccagttgagctaggacttctagataatat |
34708667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 56562 - 56481
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||| | ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
56562 |
gtgaggtcccgggttcgaacccgggtcacaacgtccgaccttgcaatttcggcatttgccagttgagctaggacttctagac |
56481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 18)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 33621575 - 33621492
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33621575 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagacaa |
33621492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 28323013 - 28322932
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| |||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28323013 |
gtgaggtcccgggttcgaacccggatcatgacgtccggccttacaatttcggcatttgccagttgagctaggacttctagac |
28322932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 33704297 - 33704216
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33704297 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
33704216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 4464208 - 4464127
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||||||| |||||| ||||||| |||| |||||||||| |
|
|
| T |
4464208 |
gtgaggtcccaggttcgaacccggatcatgacgtccggccttgcaatttcggcatttgtcagttgaactagaacttctagac |
4464127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 11572089 - 11572008
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || | |||||||||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
11572089 |
gtgaggtcccgggttcgaacccgggtcacgacgtctggccttacaatttctgcatttgttagttgagctaggacttctagac |
11572008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 21000773 - 21000692
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||| | || |||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21000773 |
gtgaggtcccgggttcgaacccaggtcatgacgtacggccttgcaatttcggcatttgccagttgagctaggacttctagac |
21000692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 38 - 100
Target Start/End: Original strand, 35218694 - 35218756
Alignment:
| Q |
38 |
cccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||| || ||||||| ||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
35218694 |
cccgggtcacaacgtccggccttgcaattttggcatttgccagttgagctaggacttctagac |
35218756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 32 - 100
Target Start/End: Complemental strand, 21037359 - 21037291
Alignment:
| Q |
32 |
ttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| || ||||||| |||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
21037359 |
ttcgaacccgagtcacaacgtccggccttgcaatttcagcatttgccagttgagctagaacttctagac |
21037291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 58 - 102
Target Start/End: Complemental strand, 14939190 - 14939146
Alignment:
| Q |
58 |
cttgcaatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
14939190 |
cttgcaatttcggcatttgccagttgagttaggacttctagacaa |
14939146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 55 - 101
Target Start/End: Complemental strand, 2959194 - 2959148
Alignment:
| Q |
55 |
ggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||||||||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
2959194 |
ggccttgcaatttcggcatttgctagttgagttaggacttctagaca |
2959148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 10226540 - 10226620
Alignment:
| Q |
20 |
tgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||| |||||||||||| || | | ||| || ||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10226540 |
tgaggtcccgggttcgaacccgtgtcacgaagtccagctttgtaatttcggaatttgccagttgagctaggacttctagac |
10226620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 49 - 88
Target Start/End: Original strand, 5598852 - 5598891
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagcta |
88 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
5598852 |
acgtctggccttgcaattttgacatttgtcagttgagcta |
5598891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 63 - 102
Target Start/End: Original strand, 28592207 - 28592246
Alignment:
| Q |
63 |
aatttcgacatttgccagttgagctaggacttctagacaa |
102 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
28592207 |
aatttcggcatttgccagttaagctaggacttctagacaa |
28592246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 55 - 101
Target Start/End: Complemental strand, 361056 - 361010
Alignment:
| Q |
55 |
ggccttgcaatttcgacatttgccagttgagctaggacttctagaca |
101 |
Q |
| |
|
||||||||||||| | |||||||||| ||||||| |||||||||||| |
|
|
| T |
361056 |
ggccttgcaattttggcatttgccagatgagctaagacttctagaca |
361010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 100
Target Start/End: Original strand, 7487350 - 7487392
Alignment:
| Q |
58 |
cttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
7487350 |
cttgtaatttcgacatttgccggttgatctaggacttctagac |
7487392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 4610872 - 4610952
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||||||||||||||| || | |||||||| ||||||||| ||||| | |||| |||||| |||||||||| |
|
|
| T |
4610872 |
gtgaggtcccaggttcgaacccgggtcatgatgtctggcc-tgcaatttcagcattttctagttaagctagaacttctagac |
4610952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 55 - 100
Target Start/End: Original strand, 24619162 - 24619207
Alignment:
| Q |
55 |
ggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||| |||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
24619162 |
ggccttacaattttgacatttgtcagttgagttaggacttctagac |
24619207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 33255569 - 33255489
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||||||||||||| | | || |||||| ||||| |||||| | |||||||||| ||||||||||||| ||||| |
|
|
| T |
33255569 |
gtgaggtcccaggttcgaactcaggtca-aacgtccagccttacaattttggcatttgccagctgagctaggacttatagac |
33255489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1348 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold1348
Description:
Target: scaffold1348; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 909 - 990
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
909 |
gtgaggtcccgggttcgaacccgggtcatgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 114333 - 114252
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| |||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
114333 |
gtgaggtcccgggttcgaacccggatcatgacgtccggccttacaatttcggcatttgccagttgagctaggacttctagac |
114252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 10021 - 10101
Alignment:
| Q |
20 |
tgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||| ||||||||||||| | | ||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10021 |
tgaggtcccgggttcgaacccgggttacgacgtccggccttgcaatttcggcatttgccagttgagctaggacttctagac |
10101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0360 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: scaffold0360
Description:
Target: scaffold0360; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 14576 - 14495
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| | ||||| |||||||||||||||||||||| ||| || |||||||||| ||||| |
|
|
| T |
14576 |
gtgaggtcccgggttcgaacccggatcacgacgtccggccttgcaatttcgacatttgtcagctgtgctaggacttatagac |
14495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 100
Target Start/End: Original strand, 8990 - 9071
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||| ||||||||||||| ||| |||||| ||||| |||||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
8990 |
gtgaggtcctaggttcgaacccgaatcataacgtcccgccttacaatttcggcatttaccagttgagctagaacttctagac |
9071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0067 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0067
Description:
Target: scaffold0067; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 49 - 96
Target Start/End: Complemental strand, 34869 - 34822
Alignment:
| Q |
49 |
acgtctggccttgcaatttcgacatttgccagttgagctaggacttct |
96 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
34869 |
acgtccggccttgcaatttcggcatttgccagttgagctaggacttct |
34822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0053 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0053
Description:
Target: scaffold0053; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 89
Target Start/End: Complemental strand, 22244 - 22174
Alignment:
| Q |
19 |
gtgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctag |
89 |
Q |
| |
|
|||||||||| || |||||||||| || | ||||| |||||| |||||||| |||||| |||||||||||| |
|
|
| T |
22244 |
gtgaggtcccgggctcgaacccgggtcacgacgtccggccttacaatttcggcatttgtcagttgagctag |
22174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0495 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0495
Description:
Target: scaffold0495; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 3259 - 3339
Alignment:
| Q |
20 |
tgaggtcccaggttcgaacccggatcgcaacgtctggccttgcaatttcgacatttgccagttgagctaggacttctagac |
100 |
Q |
| |
|
||||||||| |||||||||||| || | | ||| || ||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3259 |
tgaggtcccgggttcgaacccgtgtcacgaagtccagctttgtaatttcggaatttgccagttgagctaggacttctagac |
3339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0778 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0778
Description:
Target: scaffold0778; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 99
Target Start/End: Complemental strand, 856 - 818
Alignment:
| Q |
62 |
caatttcgacattt-gccagttgagctaggacttctaga |
99 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
856 |
caatttcgacattttgccagttgagctaggacttctaga |
818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University