View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_high_60 (Length: 323)
Name: NF19192_high_60
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_high_60 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 20222849 - 20222546
Alignment:
| Q |
1 |
atgtgcggttgtagagaaagtgatgatggtggtggggaagtgagggttgggaaggtgagtgtcgggattatgagtgttgttgattggagatatgttggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
20222849 |
atgtgcggttgtagagaaagtgatgatggtggtggggaagtgagggttgggaaggtgagtgttgggattatgagtgttgttgattggaggtatgttggta |
20222750 |
T |
|
| Q |
101 |
ttgacaatggtcttagatacttgcaacattttcttctaacttaagaactcattttgatgagtttgtaatcaatgtaatacaatagtgtagacattttatg |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
20222749 |
ttgacgatggtcttagatacttgcaacattttcttctaacttaagaactcattttgatgagtttgtaatcaatgtaatacaata--gtagacattttgtg |
20222652 |
T |
|
| Q |
201 |
tataaagctgcttttaaactcgtaggtttaaatttatttgtgataccatagcttgaatttgctcattcaataggagagtactattcgagaaatgtgtaaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||| |
|
|
| T |
20222651 |
tataaagctgcttttaaactcgtaggtttaaatttatttgtgataccatagcttgaatttgctcattcaaatagagagtactattggagtaatgtgtaaa |
20222552 |
T |
|
| Q |
301 |
ataatt |
306 |
Q |
| |
|
| |||| |
|
|
| T |
20222551 |
acaatt |
20222546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University