View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_high_76 (Length: 280)
Name: NF19192_high_76
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_high_76 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 17 - 270
Target Start/End: Original strand, 55680 - 55933
Alignment:
| Q |
17 |
ataaagtatcatagagagggactacaacgatgagaaaaatgtaaggaattgactgaagtgatgctggagggatatgaaatgattttgtgacatgtgtgtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55680 |
ataaagtatcatagagagggactacaacgatgagaaaaatgtaaggaattgactgaagtgatgctggagggatatgaaatgattttgtgacatgtgtgtc |
55779 |
T |
|
| Q |
117 |
catggcacttccttgctggaccgagaatgtttgaagttgtgctaagatagtgttgaaaattatagtgcatgcaaaaattggaataaccgaaagtaatatc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55780 |
catggcacttccttgctggaccgagaatgtttgaagttgtgctaagatagtgttgaaaattatagtgcatgcaaaaattggaataaccgaaagtaatatc |
55879 |
T |
|
| Q |
217 |
tttgcttgttcaacttgtgcaacactacacaatctccacgggctttcctctgtg |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
55880 |
tttgcttgttcaacttgtgcaacactacacaatctccacgggctttcctttgtg |
55933 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University