View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_high_85 (Length: 261)
Name: NF19192_high_85
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_high_85 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 34 - 254
Target Start/End: Original strand, 74353 - 74573
Alignment:
| Q |
34 |
ctttcaattaaaaaatatgcatgcaatataattggcagaaaacaaactgttctacatatttatgcttctcgtttttaagaattttaaaaagaacctgtca |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
74353 |
ctttcaattaaaaaatatgcatgcaatataattggcagaaaacaaactgttctacatatttatgcttctcatttttaagaattttaaaaagaacctgtca |
74452 |
T |
 |
| Q |
134 |
gaattccaaagtctaggagacagaaacaagaaaaacctggtggaaggatgccaaaccatagtctgagagacggggattcaaatctgtgtcaagcaaaata |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
74453 |
gaattccaaagtctaggagacagaaacaagaaaaacctggtggaaggatgccaaaccatagtctgagagacggggattcaaatctgtgtcaagcaaaata |
74552 |
T |
 |
| Q |
234 |
ttggcggatttgatattcttg |
254 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
74553 |
ttggcggatttgatattcttg |
74573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University