View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19192_high_86 (Length: 261)

Name: NF19192_high_86
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19192_high_86
NF19192_high_86
[»] chr5 (1 HSPs)
chr5 (56-252)||(13761327-13761522)
[»] chr3 (1 HSPs)
chr3 (28-62)||(44854265-44854299)
[»] chr2 (1 HSPs)
chr2 (26-66)||(32228175-32228215)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 56 - 252
Target Start/End: Complemental strand, 13761522 - 13761327
Alignment:
56 gagtattaattagtgttgggttactatttgtgaaaaaacagtcaattcccaatattttttgagtgaaatttatatgattaaaaacaatacaaattnnnnn 155  Q
    |||||||||||||||||||||||||||||||||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||||||||         
13761522 gagtattaattagtgttgggttactatttgtgaaaaaa-agttgattcccaatattttttgagtgaaatttatatgattaaaaacaatacaaattaaaaa 13761424  T
156 nntcatgcggtggtgttggataaatgaagggaagggaaggtcttcgtggtagagagggtggaaggagatgtagtgggtgggtcatgtcttgatgatg 252  Q
      |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||    
13761423 aatcatgcggtggtgttggataaatgaagggaagggaaggtcttcgtggtagggagggtggaaggagatgcagtgggtgggtcatgtcttgatgatg 13761327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 62
Target Start/End: Complemental strand, 44854299 - 44854265
Alignment:
28 taaaataacactcatcttaaaacggatggagtatt 62  Q
    ||||||||||||||| |||||||||||||||||||    
44854299 taaaataacactcattttaaaacggatggagtatt 44854265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 26 - 66
Target Start/End: Original strand, 32228175 - 32228215
Alignment:
26 gctaaaataacactcatcttaaaacggatggagtattaatt 66  Q
    |||||||  |||||||| |||||||||||||||||||||||    
32228175 gctaaaacgacactcattttaaaacggatggagtattaatt 32228215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University