View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_high_89 (Length: 258)
Name: NF19192_high_89
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_high_89 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 92 - 197
Target Start/End: Complemental strand, 12839014 - 12838909
Alignment:
| Q |
92 |
tagatatgcccttatattacgaaggataaatgtttgtctaatatcacaatgaataagaataatctttagttatttgatcttttgttagggcttatagtgt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12839014 |
tagatatgcccttatattacgaaggataaatgtttgtctaatatcacaatgaataagaataatctttagttatttgatcttttgttagggcttatagtgt |
12838915 |
T |
 |
| Q |
192 |
atttcc |
197 |
Q |
| |
|
|||||| |
|
|
| T |
12838914 |
atttcc |
12838909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 12 - 69
Target Start/End: Complemental strand, 12839129 - 12839072
Alignment:
| Q |
12 |
atgaaataagcaaacacaatcctcttgtgaaaagattatgtcttgtgactataagata |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12839129 |
atgaaataagcaaacacaatcctcttgtgaaaagattatgtcttgtgactataagata |
12839072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University