View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_100 (Length: 250)
Name: NF19192_low_100
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_100 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 35707110 - 35707349
Alignment:
| Q |
1 |
tttatagtggagccagcatctgtacttaacagtccatatgccaaagcgagtttttcactatgagacacaagtaaacacctctttccttcatcatcaatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35707110 |
tttatagtggagccagcatctgtacttaacagtccatatgccaaagcgagtttttcactatgagacacaagtaaacacctctttccttcatcatcaatat |
35707209 |
T |
|
| Q |
101 |
catatggcacagaatttagttttggttgatatccggcacacttcagtcgctgcaaaagatcatctaacaccttctttatctcattaatttctggatgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35707210 |
catatggcacagaatttagttttggttgatatccagtacacttcagtcgctgcaaaagatcatctaacgccttctttatctcattaatttctggatgttt |
35707309 |
T |
|
| Q |
201 |
cacatcaccagcaaagaactcgtgaataataccattcttc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35707310 |
cacatcaccagcaaagaactcgtgaataataccattcttc |
35707349 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 174 - 233
Target Start/End: Original strand, 42112382 - 42112441
Alignment:
| Q |
174 |
ctttatctcattaatttctggatgtttcacatcaccagcaaagaactcgtgaataatacc |
233 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||| | |||| |||||| |
|
|
| T |
42112382 |
ctttatcttattaatttctggatgttatacatcaccagcaaagaacacatgaacaatacc |
42112441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University