View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_101 (Length: 249)
Name: NF19192_low_101
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_101 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 13897225 - 13896987
Alignment:
| Q |
1 |
aggcgctgccgggcacaagtgattgatgcagagtaaacaatcattttgattcttaaacgcgtttgaggcagagtcataatagttggtgaatgtatcaaaa |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
13897225 |
aggcgctgccgggcgcaagtgattgatgcagagtaaacaatcattttgattcttaaacgcgtttgaggcagagtcacaatagtcggtgaatgtatcaaaa |
13897126 |
T |
 |
| Q |
101 |
ttatnnnnnnnncacatctagatatgactttcgttagtcagtttagttctcgaatgagtctttcatttattagtatgac-aaaagatacaccaattttgt |
199 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |||| ||||| ||||||| | |
|
|
| T |
13897125 |
ttat-aaaaaaacacatctagatatgactttcgttagtcagtttaattctcgaatgagtctttcatttgttagtatgacaaaaaaatacatcaattttat |
13897027 |
T |
 |
| Q |
200 |
aacttcaatatatttaggaactccagcgactacacttcat |
239 |
Q |
| |
|
|| ||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
13897026 |
aatttcaatacatttaggaactccggcgactacacttcat |
13896987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University