View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_106 (Length: 247)
Name: NF19192_low_106
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_106 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 108 - 232
Target Start/End: Original strand, 41224447 - 41224571
Alignment:
| Q |
108 |
ttgagatttgaaacttgagaaaataggaggagaaatagcgatgattcacttcttgttgttgggcacaaatggagtgatggtaannnnnnngcttacctag |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41224447 |
ttgagatttgaaacttgagaaaataggaggagaaatagcgacgattcacttcttgttgttgggcacaaatggagtgatggtaatttttttgcttacctag |
41224546 |
T |
 |
| Q |
208 |
ttaatttatttgatatcatcataat |
232 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41224547 |
ttaatttatttgatatcatcataat |
41224571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 41224320 - 41224421
Alignment:
| Q |
15 |
tgtgagaaaataatgtggaatatctagatgattgaaatatagaggggaaggttttgaaatttgaaataataaaggagaaacactagttaaggattgagat |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41224320 |
tgtgagaaaaaaatgtggaatatctagatgattgaaatatagaggggaaggttttgaaatttgaaataataaaggagaaacactagttaaggattgagat |
41224419 |
T |
 |
| Q |
115 |
tt |
116 |
Q |
| |
|
|| |
|
|
| T |
41224420 |
tt |
41224421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University