View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_113 (Length: 239)
Name: NF19192_low_113
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_113 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 20165575 - 20165796
Alignment:
| Q |
1 |
ttcaatgtttcttttacttatagcttgtctttcaagggcttatctatcatacatatatcaagcataatgaaaatattttcatatctgaaaattaattaac |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20165575 |
ttcaatgtttcttttacttatagcctgtctttcaagtgcttatctatcatacatatatcaagcataatgaaaatatttttatatctgaaaattaattaac |
20165674 |
T |
 |
| Q |
101 |
aatatatctaaaaaatggttatattgttttttacttcaatgaaaataaaaattgcaaccgcgcaacccacaagtctttaatctagttataaataaaagtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
20165675 |
aatatatctaaaaaatggttatattgttttttacttcaatgaaaataaaaattgcaaccgcgcaacccacaagtctttagtctagttataaataaaagtg |
20165774 |
T |
 |
| Q |
201 |
agttacatacgtcgttcgaatc |
222 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
20165775 |
agttatatacgtcgttcgaatc |
20165796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University