View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_124 (Length: 235)
Name: NF19192_low_124
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_124 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 213
Target Start/End: Complemental strand, 11423793 - 11423596
Alignment:
| Q |
16 |
gtttcttcctggtcgatctaagaatttcaatttataggaaagtttaaacttcaaatatttaagaataatgacaaaaggaaataaattggcgaaacatcta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11423793 |
gtttcttcctggtcgatctaagaatttcaatttataggaaagtttaaacgtcaaatatttaagaataatgacaaaaggaaataaattggtgaaacatcta |
11423694 |
T |
|
| Q |
116 |
ttaacaacacaagcagatatggtatgcaattcgattattatatcaacaaaatcacacatagatacacaaacataatgcactattgcttgagtgacaat |
213 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11423693 |
ttaacaacacaagcaaatatggtatgcaattcgattattatatcaacaaaatcacacatagatacacaaacataatgcactattgcttgagtgacaat |
11423596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 26 - 110
Target Start/End: Original strand, 32304770 - 32304854
Alignment:
| Q |
26 |
ggtcgatctaagaatttcaatttataggaaagtttaaacttcaaatatttaagaataatgacaaaaggaaataaattggcgaaac |
110 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| ||||| ||||||||||||||||| ||||| || ||||||||| ||||| |
|
|
| T |
32304770 |
ggtcgatctgagaatttcaacatataggaaagttcaaactataaatatttaagaataatagcaaaaagatataaattggtgaaac |
32304854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University