View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_128 (Length: 224)
Name: NF19192_low_128
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_128 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 61 - 224
Target Start/End: Original strand, 38664690 - 38664853
Alignment:
| Q |
61 |
ttgtcttccaatcattcatgataagttaataaatggttaatgacggctaactttcagttaccaaattcatacacaatccaaaattagggaataaatatgt |
160 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38664690 |
ttgtcttccaattattcatgataagttaataaatggttaatgacggctaactttcagttaccaaattcatacacaatccaaaattagggaataaatatgt |
38664789 |
T |
 |
| Q |
161 |
cttaaattaaaggaatattaattggtgatgactgaaatgtagaaacaaacccaatggagaatct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
38664790 |
cttaaattaaaggaatattaattggtgatgactgaaatatgtaaacaaacccaatggagaatct |
38664853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 7 - 45
Target Start/End: Original strand, 38664638 - 38664676
Alignment:
| Q |
7 |
tggacatcatcaaagtaacaattgtcttccaatttcctt |
45 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38664638 |
tggacatcaacaaagtaacaattgtcttccaatttcctt |
38664676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University