View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_33 (Length: 423)
Name: NF19192_low_33
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 25 - 407
Target Start/End: Original strand, 7346087 - 7346470
Alignment:
| Q |
25 |
ctagggggcggttgattgagggtgaaagggagaggtcggtttggtggatctttgtagcggt--gttggtgaggagatggataggttgtttgatgataact |
122 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||| |||| ||||| ||||||||||| |||||||||||||| |
|
|
| T |
7346087 |
ctagggggcggttgattgagggtggaagggagaggtcagtttgatggatctttgtagcggtacgttgatgaggtgatggataggtggtttgatgataact |
7346186 |
T |
 |
| Q |
123 |
taaggaagtcggttgcgaatggtttaaatacttatttttgtattgatttatggttagacggagtccatatgagtgttcgctttccccggcttagtcttta |
222 |
Q |
| |
|
||||||| | |||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7346187 |
taaggaatt-ggttgcgaatggtttagatacttatttttggattgatttatggttagacggagtccatatgagtattcgctttccccggcttagtcttta |
7346285 |
T |
 |
| Q |
223 |
aaatacctaagtgaccaacatatcacttaataatttagtctaaggagcgctcgtcaaagactaaatttatcttgtgtaatttagtctaatttaactgatt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7346286 |
aaatacctaagtgaccaacatatcacttaataatttagtctaaggagcgctcatcaaagactaaatttatcttgtgtaatttagtctaatttaactgatt |
7346385 |
T |
 |
| Q |
323 |
attgcaactaactattttacatctaataataacttgtggctattgcatgaatctttcaagatttgtaagatattcgatgctccat |
407 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7346386 |
attgcaactaactattttacatctaataataacttgtggctattgcatgaatccttcaagatttgtaagatattcgatgctccat |
7346470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University