View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_47 (Length: 371)
Name: NF19192_low_47
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_47 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 1 - 349
Target Start/End: Original strand, 41263857 - 41264205
Alignment:
| Q |
1 |
acagtattagcatcacaattacagatgaaagtgtcgaaaatatgcatatggaagatcactttgagtgaagatattttgattaccgtgtaataaccccttt |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263857 |
acagtattagcatcacaattatagatgaaagtgtcgaaaatatgcatatggaagatcactttgagtgaagatattttgattaccgtgtaataaccccttt |
41263956 |
T |
|
| Q |
101 |
cgatcgaggcaacagaatttcagtagataaacaggagaagatgtggtgggtttctggacgtgataaaacgaggctacacaggggggacaaattgcctgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41263957 |
cgatcgaggcaacagaatttcagtagataaacaggagaagatgtggtgggtttctggacgagataaaacgaggctacacaggggggacaaattgcctgaa |
41264056 |
T |
|
| Q |
201 |
gacggtctttcagataagaataactcatcctaggaagcaatatagattgtggaataacccacaatacaatgtagcaccacacaccatcagttgaaacatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41264057 |
gacggtctttcagataagaataactcatcctaggaagcaatatagattgtggaataacccacaatacaatgtagcaccacacaccatcagttgaaacatc |
41264156 |
T |
|
| Q |
301 |
tggataatattattcacaagaaatgatcagcatccctcaagctgcacat |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41264157 |
tggataatattattcacaagaaatgatcagcatccctcaagctgcacat |
41264205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University