View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_49 (Length: 371)
Name: NF19192_low_49
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 151 - 356
Target Start/End: Complemental strand, 39197313 - 39197108
Alignment:
| Q |
151 |
ctcaagtcaacccatatccacttgagataatttttatgtgcctgaattaacatgctattcaatagtataactttattcctcccaaaaagaaaaattagga |
250 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39197313 |
ctcaagtcaacccgtatccacttgacataatttttatgtgcctgaattaacatgctattcaatagtataactttattcctctcaaaaagaaaaattagga |
39197214 |
T |
 |
| Q |
251 |
ctacaactttattattatacaacttatgccaaactagctgcgtacgtagttaatttataaactatcatgattgttttcactttaataaacttttgtgctt |
350 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39197213 |
ctacaactttattattatacaacttatgccaaactagctgcgtacgtagttaatttataaactatcatgattgttttcactttaataaaattttgtgctt |
39197114 |
T |
 |
| Q |
351 |
gcttat |
356 |
Q |
| |
|
|||||| |
|
|
| T |
39197113 |
gcttat |
39197108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 66; Significance: 4e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 63 - 148
Target Start/End: Complemental strand, 42307653 - 42307568
Alignment:
| Q |
63 |
tgcagcaagttaaaactgccacctgcccataatggacccactttcccatcgtgggataaaactttactgccccaagttaaatgcca |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| |||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
42307653 |
tgcagcaagttaaaactgccacctgcccataatggatccacttttccatggtgggataaaattttactgccccatgttaaatgcca |
42307568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 13 - 50
Target Start/End: Complemental strand, 42307715 - 42307678
Alignment:
| Q |
13 |
tgaaatagcaagttgaaaccgaataaaataataagtaa |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42307715 |
tgaaatagcaagttgaaaccgaataaaataataagtaa |
42307678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University