View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_52 (Length: 362)
Name: NF19192_low_52
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 181 - 354
Target Start/End: Original strand, 40071245 - 40071424
Alignment:
| Q |
181 |
ttttgttatgatgataaataaataaacctctcttgtgttaatact------actactgataggttattgtatagaagcaagcaacgagggtttctcgaac |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40071245 |
ttttgttatgatgataaataaataaacctctcttgtgttactactactactactactgataggttattgtatagaagcaagcaacgagggtttctcgaac |
40071344 |
T |
|
| Q |
275 |
tcgatttggttcttggaaaatgggtacagaacaatatccactccctcgatgaaaatcatattcgatctctcattcatctc |
354 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40071345 |
tcgatctggttcttggaaaatgggtacagaacaatatccactccctcgatgaaaatcatattcgatctctcattcatctc |
40071424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 25 - 158
Target Start/End: Original strand, 40071070 - 40071203
Alignment:
| Q |
25 |
ctcaggcctgtttttctatatcataagatttcccctttcacttctcactctgattctgataacaactcgcttcacatcgatttatccaatcaagaatcca |
124 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40071070 |
ctcaggcctgtttttggatatcataagatttcccctttcacttctcactctgattctgataacaactcgcttcacatcgatttatccaatcaagaatcca |
40071169 |
T |
|
| Q |
125 |
aaagaacattgttcaacaggttggttccttttct |
158 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
40071170 |
aaagaaccttgttcaacaggttggttccttttct |
40071203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 233 - 314
Target Start/End: Original strand, 44968912 - 44968993
Alignment:
| Q |
233 |
ataggttattgtatagaagcaagcaacgagggtttctcgaactcgatttggttcttggaaaatgggtacagaacaatatcca |
314 |
Q |
| |
|
|||||||||| ||||||||||| ||||| |||||||| ||||| || ||||||||||| ||||||||| || | |||||||| |
|
|
| T |
44968912 |
ataggttattatatagaagcaaacaacgcgggtttctggaactggacttggttcttggcaaatgggtagaggataatatcca |
44968993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University