View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19192_low_65 (Length: 313)

Name: NF19192_low_65
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19192_low_65
NF19192_low_65
[»] chr6 (1 HSPs)
chr6 (11-47)||(7927831-7927867)
[»] chr5 (1 HSPs)
chr5 (262-300)||(27351179-27351217)


Alignment Details
Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 11 - 47
Target Start/End: Complemental strand, 7927867 - 7927831
Alignment:
11 tacaacccataataatttgcaaagagatgtttcaaat 47  Q
    |||||||||||||||||||||||||||||||||||||    
7927867 tacaacccataataatttgcaaagagatgtttcaaat 7927831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 262 - 300
Target Start/End: Original strand, 27351179 - 27351217
Alignment:
262 gcctccaaatgctatgagcctcaaaaaataaatttaagt 300  Q
    ||||||||||| |||| ||||||||||||||||||||||    
27351179 gcctccaaatgttatgggcctcaaaaaataaatttaagt 27351217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University