View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_74 (Length: 294)
Name: NF19192_low_74
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_74 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 5e-59; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 124 - 239
Target Start/End: Original strand, 664050 - 664165
Alignment:
| Q |
124 |
cctgcatttctttctagacactgaggcaccgcaaattttcgacgagtatcaaaaaagctaacatatccctcctcattagacaaagcaagaatatgacaaa |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
664050 |
cctgcatttctttctagacactgaggcaccgcaaattttcgacgagtatcaaaaaagctaacatatccctcctcattagacaaagcaagaatatgacaaa |
664149 |
T |
 |
| Q |
224 |
atttcgaagtctgcac |
239 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
664150 |
atttcgaagtctgcac |
664165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 12 - 87
Target Start/End: Original strand, 663938 - 664013
Alignment:
| Q |
12 |
atcatcagtgtcaacatgtcaatgtccatattgtatcaggtgttcatacttcaaatctaattaatacagcgtagat |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
663938 |
atcatcagtgtcaacatgtcaatgtccatattgtatcaggtgttcatacttcaaatctaattaatacaacgtagat |
664013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 124 - 226
Target Start/End: Complemental strand, 907971 - 907869
Alignment:
| Q |
124 |
cctgcatttctttctagacactgaggcaccgcaaattttcgacgagtatcaaaaaagctaacatatccctcctcattagacaaagcaagaatatgacaaa |
223 |
Q |
| |
|
||||||||||||||||||||| |||||| | ||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
907971 |
cctgcatttctttctagacacaaaggcacttcgaattttcaacgactatcgaaaaagctaacatatccctcctcattagacaaagcaagaatatgacaaa |
907872 |
T |
 |
| Q |
224 |
att |
226 |
Q |
| |
|
||| |
|
|
| T |
907871 |
att |
907869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University