View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19192_low_82 (Length: 270)
Name: NF19192_low_82
Description: NF19192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19192_low_82 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 22 - 256
Target Start/End: Original strand, 42236267 - 42236501
Alignment:
| Q |
22 |
caagacccaaataggacaccaaacactacacatgtcacctccattgcaagccctagcaccagtaccagcaagagcagtggtgaactgagatggaaatggg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42236267 |
caagacccaaataggacaccaaacactacacatgtcacctccattgcaagccctagcaccagtaccagcaggagcagtggtgaactgagatggaaatggg |
42236366 |
T |
 |
| Q |
122 |
tggaaaactattgttggagccatggttgtttgagaagccagaatcaatgtaatgataaatgggataacttacttcgtgattacaaaaaagttcgtgatta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236367 |
tggaaaactattgttggagccatggttgtttgagaagccagaatcaatgtaatgataaatgggataacttacttcgtgattacaaaaaagttcgtgatta |
42236466 |
T |
 |
| Q |
222 |
tgaatccaaatcagaatcatcaccacccaacaaca |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42236467 |
tgaatccaaatcagaatcatcaccacccaacaaca |
42236501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University